Pou5f1 (NM_001252452) Mouse Untagged Clone

CAT#: MC226375

Pou5f1 (untagged) - Mouse POU domain, class 5, transcription factor 1 (Pou5f1), transcript variant 2


  "NM_001252452" in other vectors (1)

Reconstitution Protocol

USD 230.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Pou5f1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Pou5f1
Synonyms NF-A3; Oct-3; Oct-3/4; Oct-4; Oct3; Oct3/4; Oct4; Otf-3; Otf-4; Otf3; Otf3-rs7; Otf3g; Otf4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226375 representing NM_001252452
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAAGCCCTGCAGAAGGAGCTAGAACAGTTTGCCAAGCTGCTGAAGCAGAAGAGGATCACCTTGGGGT
ACACCCAGGCCGACGTGGGGCTCACCCTGGGCGTTCTCTTTGGAAAGGTGTTCAGCCAGACCACCATCTG
TCGCTTCGAGGCCTTGCAGCTCAGCCTTAAGAACATGTGTAAGCTGCGGCCCCTGCTGGAGAAGTGGGTG
GAGGAAGCCGACAACAATGAGAACCTTCAGGAGATATGCAAATCGGAGACCCTGGTGCAGGCCCGGAAGA
GAAAGCGAACTAGCATTGAGAACCGTGTGAGGTGGAGTCTGGAGACCATGTTTCTGAAGTGCCCGAAGCC
CTCCCTACAGCAGATCACTCACATCGCCAATCAGCTTGGGCTAGAGAAGGATGTGGTTCGAGTATGGTTC
TGTAACCGGCGCCAGAAGGGCAAAAGATCAAGTATTGAGTATTCCCAACGAGAAGAGTATGAGGCTACAG
GGACACCTTTCCCAGGGGGGGCTGTATCCTTTCCTCTGCCCCCAGGTCCCCACTTTGGCACCCCAGGCTA
TGGAAGCCCCCACTTCACCACACTCTACTCAGTCCCTTTTCCTGAGGGCGAGGCCTTTCCCTCTGTTCCC
GTCACTGCTCTGGGCTCTCCCATGCATTCAAACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001252452
ORF Size 666 bp
Insert Size 666
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001252452.1, NP_001239381.1
RefSeq Size 991
RefSeq ORF 666
Locus ID 18999
Gene Summary The protein encoded by this gene belongs to the POU domain family of transcription factors. POU domain transcription factors bind to a specific octamer DNA motif and regulate cell type-specific differentiation pathways. The encoded protein plays a key role in embryonic development and stem cell pluripotency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and uses a downstream, in-frame start codon, compared to variant 1. the encoded isoform (2) has a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.