Rab27a (NM_001301230) Mouse Untagged Clone

CAT#: MC226378

Rab27a (untagged) - Mouse RAB27A, member RAS oncogene family (Rab27a), transcript variant 1


  "NM_001301230" in other vectors (1)

Reconstitution Protocol

USD 230.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Rab27a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rab27a
Synonyms 2210402C08Rik; 2410003M20Rik; 4933437C11Rik; ash
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226378 representing NM_001301230
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGGATGGAGATTACGATTACCTCATCAAGTTCTTGGCCTTGGGAGACTCTGGGGTAGGGAAGACCA
GTGTACTCTACCAGTACACTGATGGCAAGTTCAACTCCAAATTCATCACCACAGTGGGCATTGATTTCAG
GGAAAAGAGAGTGGTGTACAGAGCCAATGGGCCAGATGGAGCTGTGGGCCGAGGCCAGAGAATCCACCTG
CAGTTATGGGACACGGCGGGGCAGGAGAGGTTTCGTAGCTTAACCACTGCATTCTTCAGGGACGCTATGG
GTTTCCTGCTTCTGTTCGACCTGACAAATGAGCAAAGTTTCCTCAATGTCCGAAACTGGATAAGCCAGCT
ACAGATGCACGCGTACTGTGAAAACCCAGATATAGTGCTGTGTGGAAATAAGAGTGACCTGGAAGACCAG
AGGGCAGTGAAAGAGGAGGAGGCCCGGGAACTTGCCGAGAAGTACGGAATCCCCTATTTTGAAACCAGTG
CTGCCAACGGGACAAACATAAGCCACGCGATTGAGATGCTCCTGGACCTGATCATGAAGCGGATGGAGCG
GTGTGTGGACAAGTCCTGGATTCCGGAGGGAGTGGTACGGTCCAACGGCCATACCTCTGCGGATCAGCTA
AGTGAGGAGAAGGAGAAGGGGTTGTGTGGCTGTTGA


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001301230
ORF Size 666 bp
Insert Size 666
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001301230.1, NP_001288159.1
RefSeq Size 3215
RefSeq ORF 666
Locus ID 11891
Gene Summary The protein encoded by this gene is a member of the Rab family of proteins, which is the largest family within the Ras superfamily of GTPases. This gene product is thought to regulate vesicular transport, together with its specific effectors. Mutations in this gene cause several defects, including actin-based melanosome transport defects and immunodeficiency. Mutations in the human ortholog of this gene are associated with Griscelli syndrome type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2, and 3 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.