Rchy1 (NM_001271797) Mouse Untagged Clone

CAT#: MC226380

Rchy1 (untagged) - Mouse ring finger and CHY zinc finger domain containing 1 (Rchy1), transcript variant 2


  "NM_001271797" in other vectors (1)

Reconstitution Protocol

USD 230.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Rchy1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rchy1
Synonyms ARNIP; CHIMP; Pirh2; Zfp363; Znf363
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226380 representing NM_001271797
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGCGACGGCGCGGGAAGATGGCGTCCGCAACCTGGCGCAGGGGCCGCGGGGCTGCGAGCACTATG
ACAGAGCTTGTCTCCTCAAGGCCCAGCAGACTTGTGAAGACTGTAGCACATTGTTTGGAGAATATTACTG
CAGTATTTGCCACCTGTTTGACAAAGATAAGAGGCAGTACCACTGTGAGAGCTGTGGGATTTGTAGGATT
GGTCCAAAGGAAGATTTTTTCCATTGCTTGAAATGTAATTTATGCCTAACCACGAATCTTCGAGGAAAAC
ACAAGTGTATTGAAAATGTTTCCCGGCAGAATTGTCCAATATGCTTGGAGGACATTCACACCTCCCGTGT
TGTTGCTCACGTCTTGCCGTGTGGGCATCTCCTACATAGAACGTGTTATGAAGAAATGTTGAAAGAAGGT
TACAGATGCCCATTGTGTATGCATTCTGCCTTAGACATGACTCGGTACTGGAGACAACTAGATACTGAGG
TAGCACAGACTCCCATGCCATCCGAATACCAGAACGTGACTGTTGACATTCTCTGCAATGACTGTAATGG
ACGATCCACAGTCCAGTTCCATATCTTAGGCATGAAATGTAAGCTTTGTGACTCCTACAATACTGCCCAA
GCTGGAGGCCGTAGAGTGCCAGTGGATCAGCAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001271797
ORF Size 666 bp
Insert Size 666
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001271797.1, NP_001258726.1
RefSeq Size 1909
RefSeq ORF 666
Locus ID 68098
Gene Summary This gene encodes a protein containing CHY-, CTCHY-, and RING-type zinc-fingers. The encoded protein functions as an E3 ubiquitin ligase, and mediates the degradation of target proteins such as p53. The activity of this protein is important in cell cycle regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.