Artn (NM_001284193) Mouse Untagged Clone

CAT#: MC226398

Artn (untagged) - Mouse artemin (Artn), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Artn
• Synonyms: neublastin
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226398 representing NM_001284193
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAACTGGGACTTGCAGAGCCTACTGCATTGTCCCACTGCCTCCGGCCTAGGTGGCAGTCAGCCTGGT
  GGCCAACCCTAGCTGTTCTAGCCCTGCTGAGCTGCGTCACAGAAGCTTCCCTGGACCCAATGTCCCGCAG
  CCCCGCCGCTCGCGACGGTCCCTCACCGGTCTTGGCGCCCCCCACGGACCACCTGCCTGGGGGACACACT
  GCGCATTTGTGCAGCGAAAGAACCCTGCGACCCCCGCCTCAGTCTCCTCAGCCCGCACCCCCGCCGCCTG
  GTCCCGCGCTCCAGTCTCCTCCCGCTGCGCTCCGCGGGGCACGCGCGGCGCGTGCAGGAACCCGGAGCAG
  CCGCGCACGGACCACAGATGCGCGCGGCTGCCGCCTGCGCTCGCAGCTGGTGCCGGTGAGTGCGCTCGGC
  CTAGGCCACAGCTCCGACGAGCTGATACGTTTCCGCTTCTGCAGCGGCTCGTGCCGCCGAGCACGCTCCC
  AGCACGATCTCAGTCTGGCCAGCCTACTGGGCGCTGGGGCCCTACGGTCGCCTCCCGGGTCCCGGCCGAT
  CAGCCAGCCCTGCTGCCGGCCCACTCGCTATGAGGCCGTCTCCTTCATGGACGTGAACAGCACCTGGAGG
  ACCGTGGACCACCTCTCCGCCACTGCCTGCGGCTGTCTGGGCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001284193
• ORF Size: 675 bp
• Insert Size: 675
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001284193.1, NP_001271122.1
• RefSeq Size: 2323
• RefSeq ORF: 675
• Locus ID: 11876
• Gene Summary: This gene encodes a secreted ligand of the glial cell line-derived neurotrophic factor (GDNF) subfamily and TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein signals through the RET receptor and GFR alpha 3 coreceptor, and supports the survival of a number of peripheral neuron populations and at least one population of dopaminergic CNS neurons. Mice lacking a functional copy of this gene exhibit ptosis and impaired development of the sympathetic nervous system. [provided by RefSeq, Aug 2016]
  Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. Variants 1, 2, and 3 encode the same protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.