Gdnf (NM_001301333) Mouse Untagged Clone

CAT#: MC226442

Gdnf (untagged) - Mouse glial cell line derived neurotrophic factor (Gdnf), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Gdnf
• Synonyms: AI385739; ATF
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226442 representing NM_001301333
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAAAATGAATTCGTCTCCGCAGCAGTGGGAGGTGCCGCCGCCGGACGGGACTCTAAGATGAAGTTAT
  GGGATGTCGTGGCTGTCTGCCTGGTGTTGCTCCACACCGCGTCTGCCTTCCCGCTGCCCGCCGGTAAGAG
  GCTTCTCGAAGCGCCCGCTGAAGACCACTCCCTCGGCCACCGCCGCGTGCCCTTCGCGCTGACCAGTGAC
  TCCAATATGCCTGAAGATTATCCTGACCAGTTTGATGACGTCATGGATTTTATTCAAGCCACCATTAAAA
  GACTGAAAAGGTCACCAGATAAACAAGCGGCAGCGCTTCCTCGAAGAGAGAGGAATCGGCAGGCTGCAGC
  TGCCAGCCCAGAGAATTCCAGAGGGAAAGGTCGCAGAGGCCAGAGGGGCAAAAATCGGGGGTGCGTTTTA
  ACTGCCATACACTTAAATGTCACTGACTTGGGTTTGGGCTATGAAACCAAGGAGGAACTGATCTTTCGAT
  ATTGCAGCGGTTCCTGTGAATCGGCCGAGACAATGTATGACAAAATACTAAAAAACCTGTCTCGGAGTAG
  AAGGCTAACAAGTGACAAAGTAGGCCAGGCATGTTGCAGGCCGGTCGCCTTCGACGACGACCTGTCGTTT
  TTAGATGACAACCTGGTTTACCATATTCTAAGAAAGCATTCCGCTAAACGGTGTGGATGTATCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301333
• ORF Size: 696 bp
• Insert Size: 696
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001301333.1, NP_001288262.1
• RefSeq Size: 3761
• RefSeq ORF: 696
• Locus ID: 14573
• Gene Summary: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The recombinant form of this protein, a highly conserved neurotrophic factor, was shown to promote the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. This protein is a ligand for the product of the RET (rearranged during transfection) protooncogene. Homozygous knockout mice for this gene exhibit defects in kidney development and neonatal death. This gene encodes multiple protein isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]
  Transcript Variant: This variant (3) differs in the 5' UTR and 5' coding region, compared to variant 1. The resulting isoform (3) has a shorter and distinct N-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.