Bcl2l1 (NM_001289717) Mouse Untagged Clone

CAT#: MC226458

Bcl2l1 (untagged) - Mouse BCL2-like 1 (Bcl2l1), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Bcl2l1
• Synonyms: Bcl(X)L; bcl-x; Bcl-XL; bcl2-L-1; Bcl2l; BclX
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226458 representing NM_001289717
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCTCAGAGCAACCGGGAGCTGGTGGTCGACTTTCTCTCCTACAAGCTTTCCCAGAAAGGATACAGCT
  GGAGTCAGTTTAGTGATGTCGAAGAGAATAGGACTGAGGCCCCAGAAGAAACTGAAGCAGAGAGGGAGAC
  CCCCAGTGCCATCAATGGCAACCCATCCTGGCACCTGGCGGATAGCCCGGCCGTGAATGGAGCCACTGGC
  CACAGCAGCAGTTTGGATGCGCGGGAGGTGATTCCCATGGCAGCAGTGAAGCAAGCGCTGAGAGAGGCAG
  GCGATGAGTTTGAACTGCGGTACCGGAGAGCGTTCAGTGATCTAACATCCCAGCTTCACATAACCCCAGG
  GACCGCGTATCAGAGCTTTGAGCAGGTAGTGAATGAACTCTTTCGGGATGGAGTAAACTGGGGTCGCATC
  GTGGCCTTTTTCTCCTTTGGCGGGGCACTGTGCGTGGAAAGCGTAGACAAGGAGATGCAGGTATTGGTGA
  GTCGGATTGCAAGTTGGATGGCCACCTATCTGAATGACCACCTAGAGCCTTGGATCCAGGAGAACGGCGG
  CTGGGACACTTTTGTGGATCTCTACGGGAACAATGCAGCAGCCGAGAGCCGGAAAGGCCAGGAGCGCTTC
  AACCGCTGGTTCCTGACGGGCATGACTGTGGCTGGTGTGGTTCTGCTGGGCTCACTCTTCAGTCGGAAGT
  GA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001289717
• ORF Size: 702 bp
• Insert Size: 702
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001289717.1, NP_001276646.1
• RefSeq Size: 2472
• RefSeq ORF: 702
• Locus ID: 12048
• Gene Summary: This gene encodes a member of the Bcl-2 family of apoptosis regulators. The encoded protein is localized to the inner and outer mitochondrial membranes and regulates the programmed cell death pathway during development and tissue homeostasis. This protein binds to voltage-dependent anion channels in the outer mitochondrial membrane to facilitate the uptake of calcium ions. Mice embryos lacking this gene survived for two weeks and exhibited cell death of immature hematopoietic cells and neurons. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jan 2014]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 5. Variants 1, 2, 3, and 5 all encode the same isoform (a, also known as Bcl-xL; PMID 7607090). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.