Pomc (NM_001278581) Mouse Untagged Clone

CAT#: MC226466

Pomc (untagged) - Mouse pro-opiomelanocortin-alpha (Pomc), transcript variant 1


  "NM_001278581" in other vectors (1)

Reconstitution Protocol

USD 240.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Pomc"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Pomc
Synonyms ACTH; alpha-MSH; alphaMSH; BE; Beta-LPH; beta-MSH; Clip; Gamma-LPH; gamma-MSH; Npp; Pomc-1; Pomc1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226466 representing NM_001278581
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCGAGATTCTGCTACAGTCGCTCAGGGGCCCTGTTGCTGGCCCTCCTGCTTCAGACCTCCATAGATG
TGTGGAGCTGGTGCCTGGAGAGCAGCCAGTGCCAGGACCTCACCACGGAGAGCAACCTGCTGGCTTGCAT
CCGGGCTTGCAAACTCGACCTCTCGCTGGAGACGCCCGTGTTTCCTGGCAACGGAGATGAACAGCCCCTG
ACTGAAAACCCCCGGAAGTACGTCATGGGTCACTTCCGCTGGGACCGCTTCGGCCCCAGGAACAGCAGCA
GTGCTGGCAGCGCGGCGCAGAGGCGTGCGGAGGAAGAGGCGGTGTGGGGAGATGGCAGTCCAGAGCCGAG
TCCACGCGAGGGCAAGCGCTCCTACTCCATGGAGCACTTCCGCTGGGGCAAGCCGGTGGGCAAGAAACGG
CGCCCGGTGAAGGTGTACCCCAACGTTGCTGAGAACGAGTCGGCGGAGGCCTTTCCCCTAGAGTTCAAGA
GGGAGCTGGAAGGCGAGCGGCCATTAGGCTTGGAGCAGGTCCTGGAGTCCGACGCGGAGAAGGACGACGG
GCCCTACCGGGTGGAGCACTTCCGCTGGAGCAACCCGCCCAAGGACAAGCGTTACGGTGGCTTCATGACC
TCCGAGAAGAGCCAGACGCCCCTGGTGACGCTCTTCAAGAACGCCATCATCAAGAACGCGCACAAGAAGG
GCCAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001278581
ORF Size 708 bp
Insert Size 708
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001278581.1, NP_001265510.1
RefSeq Size 1214
RefSeq ORF 708
Locus ID 18976
Gene Summary This gene encodes a polypeptide hormone precursor that undergoes extensive, tissue-specific, post-translational processing. Processing yields several biologically active peptides, which are involved in diverse cellular functions, such as energy homeostasis, steroidogenesis, and increased melanin production in melanocytes. In mouse deficiency of this gene is associated with obesity, defects in adrenal development, and altered pigmentation. A pseudogene of this gene is located on chromosome 19. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2, 3, 4, and 5 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.