Bcl2l1 (NM_001289739) Mouse Untagged Clone

CAT#: MC226470

Bcl2l1 (untagged) - Mouse BCL2-like 1 (Bcl2l1), transcript variant 4


  "NM_001289739" in other vectors (1)

Reconstitution Protocol

USD 240.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Bcl2l1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Bcl2l1
Synonyms Bcl(X)L; bcl-x; Bcl-XL; bcl2-L-1; Bcl2l; BclX
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226470 representing NM_001289739
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTCAGAGCAACCGGGAGCTGGTGGTCGACTTTCTCTCCTACAAGCTTTCCCAGAAAGGATACAGCT
GGAGTCAGTTTAGTGATGTCGAAGAGAATAGGACTGAGGCCCCAGAAGAAACTGAAGCAGAGAGGGAGAC
CCCCAGTGCCATCAATGGCAACCCATCCTGGCACCTGGCGGATAGCCCGGCCGTGAATGGAGCCACTGGC
CACAGCAGCAGTTTGGATGCGCGGGAGGTGATTCCCATGGCAGCAGTGAAGCAAGCGCTGAGAGAGGCAG
GCGATGAGTTTGAACTGCGGTACCGGAGAGCGTTCAGTGATCTAACATCCCAGCTTCACATAACCCCAGG
GACCGCGTATCAGAGCTTTGAGCAGGTAGTGAATGAACTCTTTCGGGATGGAGTAAACTGGGGTCGCATC
GTGGCCTTTTTCTCCTTTGGCGGGGCACTGTGCGTGGAAAGCGTAGACAAGGAGATGCAGGTATTGGTGA
GTCGGATTGCAAGTTGGATGGCCACCTATCTGAATGACCACCTAGAGCCTTGGATCCAGGAGAACGGCGG
CTGGGGTGTGAGTGGAGGTACACCCCTCAGATCTGTCTTCAGAAGGCTTGTTCAAGTGCCAGGAGTGGCG
GAGCACGTTTGTGATCCCAGCCTTTGGGAGGTGGAAACAGAAGGATCGGAAGTTCAAGGCCCTCCTCAGC
TATTATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289739
ORF Size 708 bp
Insert Size 708
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001289739.1, NP_001276668.1
RefSeq Size 1450
RefSeq ORF 708
Locus ID 12048
Gene Summary This gene encodes a member of the Bcl-2 family of apoptosis regulators. The encoded protein is localized to the inner and outer mitochondrial membranes and regulates the programmed cell death pathway during development and tissue homeostasis. This protein binds to voltage-dependent anion channels in the outer mitochondrial membrane to facilitate the uptake of calcium ions. Mice embryos lacking this gene survived for two weeks and exhibited cell death of immature hematopoietic cells and neurons. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (4) has a different 3' structure resulting in a frameshift compared to variant 5. The resulting isoform (b, also known as Bcl-x gamma; PMID 9390687) has a distinct C-terminus and is longer than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.