G6pc2 (NM_001289856) Mouse Untagged Clone

CAT#: MC226500

G6pc2 (untagged) - Mouse glucose-6-phosphatase, catalytic, 2 (G6pc2), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: G6pc2
• Synonyms: G6pc-rs; IGRP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226500 representing NM_001289856
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGCTCATCGTGCGTCTGGTATGTCATGGTAACAGCTGCCCTAAGCTACACCATCAGCCGGATGGAGG
  AGTCCTCTGTCACTCTGCACAGACTGACCTGGTCCTTTCTGTGGAGTGTTTTCTGGTTGATTCAAATCAG
  CGTCTGCATCTCAAGAGTATTCATAGCCACACATTTCCCCCATCAGGTCATTCTTGGAGTGATTGGTGGG
  ATGCTAGTAGCCGAGGCCTTTGAACACACTCCAGGAGTCCACATGGCCAGCTTGAGTGTGTACCTGAAGA
  CCAACGTCTTCCTCTTCCTGTTTGCCCTCGGCTTTTACCTGCTTCTCCGACTGTTCGGTATTGACCTGCT
  GTGGTCCGTGCCCATCGCCAAAAAGTGGTGTGCCAACCCAGACTGGATCCACATTGACAGCACGCCTTTT
  GCTGGACTCGTGAGAAACCTCGGGGTCCTCTTTGGCTTGGGTTTCGCCATCAACTCAGAAATGTTCCTTC
  GGAGCTGCCAGGGAGAAAATGGCACCAAGCCGAGCTTCCGCTTGCTCTGTGCTCTGACCTCACTGACCAC
  AATGCAACTTTATCGCTTCATCAAGATCCCGACTCACGCGGAACCTTTATTTTACCTGTTGTCTTTCTGT
  AAAAGTGCGTCCATCCCCCTGATGGTGGTGGCTCTAATTCCCTACTGTGTACATATGTTAATGAGACCCG
  GTGACAAGAAGACTAAATAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001289856
• ORF Size: 720 bp
• Insert Size: 720
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001289856.1, NP_001276785.1
• RefSeq Size: 1846
• RefSeq ORF: 720
• Locus ID: 14378
• Gene Summary: This gene encodes an enzyme that belongs to the glucose-6-phosphatase catalytic subunit family. Members of this family catalyze the hydrolysis of glucose-6-phosphate, the terminal step in gluconeogenic and glycogenolytic pathways, to release glucose into the bloodstream. The family member encoded by this gene is found specifically in pancreatic islets but has not been shown to have phosphotransferase or phosphatase activity exhibited by a similar liver enzyme. The non-obese diabetic (NOD) mouse is a model for human type 1 diabetes, an autoimmune disease in which T lymphocytes attack and destroy insulin-producing pancreatic beta cells. In NOD mice, the protein encoded by this gene is a major target of cell-mediated autoimmunity. Variations in the human and mouse genes are associated with lower fasting plasma glucose levels. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
  Transcript Variant: This variant (2) contains an alternate 5' terminal exon, lacks a portion of the 5' coding region and initiates translation at a downstream start codon compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1.