Snrpn (NM_013670) Mouse Untagged Clone

CAT#: MC226510

Snrpn (untagged) - Mouse small nuclear ribonucleoprotein N (Snrpn), transcript variant 1


  "NM_013670" in other vectors (1)

Reconstitution Protocol

USD 250.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Snrpn"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Snrpn
Synonyms 2410045I01Rik; HCERN3; Peg4; sm-D; SMN; snRNP-N
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226510 representing NM_013670
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACTGTGGGTAAGAGTAGCAAGATGCTGCAGCACATTGACTATAGGATGAGATGTATCCTGCAAGATG
GGAGAATCTTCATTGGCACCTTCAAGGCTTTTGACAAGCATATGAATTTGATCCTCTGTGATTGTGATGA
GTTCAGGAAGATCAAGCCAAAGAATGCAAAACAGCCAGAACGTGAAGAAAAACGGGTTTTGGGTCTGGTC
TTGCTACGTGGGGAGAACTTGGTTTCAATGACTGTGGAGGGCCCACCTCCTAAAGATACTGGCATTGCTC
GTGTGCCTCTTGCTGGCGCTGCAGGTGGCCCTGGGGTTGGAAGAGCAGCTGGCAGAGGAGTGCCAGCAGG
TGTACCTATTCCCCAGGCTCCTGCTGGATTAGCAGGCCCTGTCAGAGGAGTTGGAGGCCCATCCCAGCAG
GTCATGACCCCACAGGGAAGAGGCACTGTTGCAGCTGCTGCTGTTGCTGCTACTGCTAGCATTGCAGGAG
CCCCAACCCAGTACCCGCCAGGACGGGGAACTCCACCTCCACCTGTAGGCAGAGCAACCCCACCTCCAGG
CATTATGGCTCCTCCACCTGGTATGAGACCACCCATGGGCCCACCCATTGGGCTTCCCCCTGCTCGTGGG
ACACCTATAGGCATGCCTCCTCCAGGAATGAGACCCCCTCCACCAGGAATTAGAGGCCCACCTCCCCCAG
GAATGCGCCCACCAAGACCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013670
ORF Size 723 bp
Insert Size 723
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_013670.3, NP_038698.1
RefSeq Size 1970
RefSeq ORF 723
Locus ID 20646
Gene Summary This locus represents a paternally-expressed imprinted gene that encodes a component of the small nuclear ribonucleoprotein complex, which functions in pre-mRNA processing. Genomic and genetic changes in this region result in growth defects and lethality; the corresponding region in human is the critical region for Prader-Willi Syndrome. Alternative promoter use and alternative splicing result in a multitude of transcript variants encoding the same protein. Transcript variants may be bicistronic and also encode the SNRPN upstream reading frame protein (Snurf) from an upstream open reading frame. In addition, long spliced transcripts for small nucleolar RNA host gene 14 (Snhg14) may originate from the promoters at this locus and incorporate exons shared with this gene. [provided by RefSeq, Mar 2017]
Transcript Variant: This variant (1) represents the predominant variant. This splice variant is bicistronic and can also encode the Snurf protein from an upstream open reading frame.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.