March8 (NM_001302385) Mouse Untagged Clone

CAT#: MC226547

42071 (untagged) - Mouse membrane-associated ring finger (C3HC4) 8 (March8), transcript variant 4


  "NM_001302385" in other vectors (1)

Reconstitution Protocol

USD 250.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "March8"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol March8
Synonyms 1300017E09Rik; MARCH-VIII; Mir
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226547 representing NM_001302385
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTCATCCAAGCAACATTTCTAAGGCTGGGAGTAGTCCTCCATCCACGACGGCTCCAGTGTCTGCCT
TCTCTCGCACTTCTGTCACACCATCCAACCAGGACATCTGCAGGATCTGCCACTGTGAAGGGGATGACGA
GAGCCCTCTGATCACCCCCTGTCACTGCACAGGGAGCCTCCATTTCGTGCATCAGGCTTGCCTGCAGCAG
TGGATCAAGAGTTCTGACACACGCTGCTGTGAACTCTGCAAGTACGAGTTCATCATGGAGACCAAGCTGA
AACCTTTGAGGAAATGGGAGAAGTTGCAGATGACTGCCAGTGAGCGCAGGAAGATCATGTGCTCAGTGAC
CTTCCATGTCATTGCTATCACCTGTGTGGTCTGGTCCTTGTATGTGCTCATTGACCGCACAGCAGAGGAA
ATCAAGCAGGGTCAGGTAACAGGAATCCTAGAGTGGCCTTTCTGGACGAAGCTGGTAGTTGTGGCCATCG
GCTTCACTGGAGGACTTCTCTTTATGTATGTTCAGTGCAAGGTGTACCTACAGTTATGGAAAAGACTCAA
GGCTTACAATAGAGTGATCTATGTTCAGAACTGTCCAGAAACAAGTAAAAAGAATATTTTTGAAAAGTCT
GCACTTACAGAGCCCACCCTTGAAAATAAAGAAGGACATGGAATGTGTCATTCCACCACAAATTCTTCTT
GCACAGAGCCTGAAGACACTGGAGCAGAAATTATTAACGTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001302385
ORF Size 744 bp
Insert Size 744
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001302385.1, NP_001289314.1
RefSeq Size 4313
RefSeq ORF 744
Locus ID 71779
Gene Summary The protein encoded by this gene is a member of the membrane-associated really interesting new gene-CH family of proteins. These proteins are E3 ubiquitin-protein ligases that modulate antigen presentation by downregulating major histocompatibility complex class II surface expression through endocytosis. The transcript is primarily expressed by dendritic cells and macrophages. Overexpression of this gene in antigen presenting cells results in immune defective phenotypes, including resistance to autoimmune disease onset. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Transcript Variant: This variant (4) differs in the 5' UTR and lacks an alternate exon in the 5' coding region, which results in use of a downstream start codon compared to variant 1. It encodes isoform 2, which has a shorter N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.