Tpm3 (NM_001293749) Mouse Untagged Clone

CAT#: MC226550

Tpm3 (untagged) - Mouse tropomyosin 3, gamma (Tpm3), transcript variant Tpm3.4


  "NM_001293749" in other vectors (1)

Reconstitution Protocol

USD 250.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Tpm3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Tpm3
Synonyms gamma-TM; hTM30nm; hTMnm; Tm5NM; TM30nm; TMnm; Tpm-5; Tpm5; Trop-5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226550 representing NM_001293749
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCGGGACCACCACCATCGAGGCGGTAAAGCGCAAGATCCAGGTTCTGCAGCAGCAAGCTGATGATG
CGGAGGAAAGGGCCGAGCGCCTCCAGCGGGAAGTGGAGGGAGAAAGGCGGGCCCGGGAGCAGGCTGAAGC
TGAGGTGGCCTCCTTGAACCGCAGGATCCAGCTGGTTGAAGAGGAGCTGGACCGTGCGCAGGAGCGCCTT
GCCACTGCTTTGCAGAAGCTGGAGGAAGCAGAGAAGGCTGCTGATGAGAGTGAGAGAGGTATGAAGGTGA
TTGAAAATCGGGCTCTAAAAGATGAAGAAAAGATGGAACTCCAGGAAATCCAGCTAAAGGAAGCAAAGCA
CATTGCAGAAGAGGCCGATAGGAAGTATGAAGAGGTGGCTCGTAAGTTGGTGATTATTGAAGGAGACTTG
GAACGCACGGAGGAACGTGCTGAGCTGGCAGAGTCTAAGTGTTCTGAGCTGGAGGAGGAGCTGAAGAATG
TCACCAACAACCTCAAGTCTCTTGAGGCTCAGGCGGAGAAGTACTCTCAAAAAGAAGACAAGTATGAAGA
AGAAATAAAGATTCTTACTGATAAACTCAAGGAGGCAGAGACCCGTGCTGAGTTTGCTGAAAGATCGGTA
GCCAAGCTGGAGAAGACCATTGATGACCTGGAAGAGCGTCTCTACAGCCAACTTGAGCGAAACCGCCTGC
TTTCTAATGAGCTGAAGCTAACGCTGCATGGTCTTTGTGACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001293749
ORF Size 744 bp
Insert Size 744
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001293749.1, NP_001280678.1
RefSeq Size 1298
RefSeq ORF 744
Locus ID 59069
Gene Summary Binds to actin filaments in muscle and non-muscle cells. Plays a central role, in association with the troponin complex, in the calcium dependent regulation of vertebrate striated muscle contraction. Smooth muscle contraction is regulated by interaction with caldesmon. In non-muscle cells is implicated in stabilizing cytoskeleton actin filaments. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (6, also known as variant Tpm3.4) represents the use of an alternate promoter, differs in the 5' and 3' structures and has multiple differences in the coding region compared to variant Tpm3.13. These differences cause translation initiation at an alternate start codon compared to variant Tpm3.13. The encoded isoform (Tpm3.4cy, also known as isoform 6) has distinct N- and C- termini and is shorter than isoform Tpm3.13cy. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.