Tpm3 (NM_001293749) Mouse Untagged Clone

CAT#: MC226550

Tpm3 (untagged) - Mouse tropomyosin 3, gamma (Tpm3), transcript variant Tpm3.4

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tpm3
• Synonyms: gamma-TM; hTM30nm; hTMnm; Tm5NM; TM30nm; TMnm; Tpm-5; Tpm5; Trop-5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226550 representing NM_001293749
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCGGGACCACCACCATCGAGGCGGTAAAGCGCAAGATCCAGGTTCTGCAGCAGCAAGCTGATGATG
  CGGAGGAAAGGGCCGAGCGCCTCCAGCGGGAAGTGGAGGGAGAAAGGCGGGCCCGGGAGCAGGCTGAAGC
  TGAGGTGGCCTCCTTGAACCGCAGGATCCAGCTGGTTGAAGAGGAGCTGGACCGTGCGCAGGAGCGCCTT
  GCCACTGCTTTGCAGAAGCTGGAGGAAGCAGAGAAGGCTGCTGATGAGAGTGAGAGAGGTATGAAGGTGA
  TTGAAAATCGGGCTCTAAAAGATGAAGAAAAGATGGAACTCCAGGAAATCCAGCTAAAGGAAGCAAAGCA
  CATTGCAGAAGAGGCCGATAGGAAGTATGAAGAGGTGGCTCGTAAGTTGGTGATTATTGAAGGAGACTTG
  GAACGCACGGAGGAACGTGCTGAGCTGGCAGAGTCTAAGTGTTCTGAGCTGGAGGAGGAGCTGAAGAATG
  TCACCAACAACCTCAAGTCTCTTGAGGCTCAGGCGGAGAAGTACTCTCAAAAAGAAGACAAGTATGAAGA
  AGAAATAAAGATTCTTACTGATAAACTCAAGGAGGCAGAGACCCGTGCTGAGTTTGCTGAAAGATCGGTA
  GCCAAGCTGGAGAAGACCATTGATGACCTGGAAGAGCGTCTCTACAGCCAACTTGAGCGAAACCGCCTGC
  TTTCTAATGAGCTGAAGCTAACGCTGCATGGTCTTTGTGACTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001293749
• ORF Size: 744 bp
• Insert Size: 744
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001293749.1, NP_001280678.1
• RefSeq Size: 1298
• RefSeq ORF: 744
• Locus ID: 59069
• Gene Summary: Binds to actin filaments in muscle and non-muscle cells. Plays a central role, in association with the troponin complex, in the calcium dependent regulation of vertebrate striated muscle contraction. Smooth muscle contraction is regulated by interaction with caldesmon. In non-muscle cells is implicated in stabilizing cytoskeleton actin filaments. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (6, also known as variant Tpm3.4) represents the use of an alternate promoter, differs in the 5' and 3' structures and has multiple differences in the coding region compared to variant Tpm3.13. These differences cause translation initiation at an alternate start codon compared to variant Tpm3.13. The encoded isoform (Tpm3.4cy, also known as isoform 6) has distinct N- and C- termini and is shorter than isoform Tpm3.13cy. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.