Folr2 (NM_001303239) Mouse Untagged Clone

CAT#: MC226582

Folr2 (untagged) - Mouse folate receptor 2 (fetal) (Folr2), transcript variant 1


  "NM_001303239" in other vectors (1)

Reconstitution Protocol

USD 270.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Folr2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Folr2
Synonyms FBP2; Folbp-2; Folbp2; FR-beta; FR-P3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226582 representing NM_001303239
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCTGGAAACAGACACCACTCTTGCTTTTGGTCTACATGGTCACAACAGGCAGTGGCCGGGACAGAA
CAGACCTACTCAACGTTTGCATGGATGCCAAACACCATAAGACAAAGCCGGGCCCCGAGGACAAGCTGCA
TGACCAGTGTAGTCCATGGAAGAAAAATGCCTGTTGCTCAGTCAACACCAGCCAGGAGCTACACAAGGCT
GACTCCCGTCTGTACTTCAACTGGGATCACTGTGGCAAGATGGAGCCTGCCTGTAAGAGTCACTTCATCC
AAGACTCCTGCCTGTATGAGTGCTCCCCCAACCTTGGGCCTTGGATCCAGCAAGTGGACCAGAGTTGGCG
TAAAGAGCGTTTCCTGGATGTGCCCTTATGCAAAGAGGACTGTCACCAGTGGTGGGAAGCCTGTCGTACC
TCCTTTACCTGCAAGAGAGACTGGCATAAAGGCTGGGACTGGTCCTCAGGCATTAACAAGTGCCCAAACA
CAGCACCCTGTCACACGTTTGAGTACTACTTCCCGACACCAGCCAGCCTTTGCGAGGGTCTCTGGAGTCA
CTCCTACAAGGTCAGCAACTACAGCAGAGGGAGTGGCCGCTGCATCCAGATGTGGTTTGACTCAACCCAG
GGCAATCCGAATGAGGACGTGGTGAAGTTTTATGCTTCCTTTATGACATCTGGGACTGTGCCCCATGCAG
CAGTACTTCTTGTGCCCAGCCTGGCCCCAGTGCTGTCATTATGGCTCCCTGGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001303239
ORF Size 756 bp
Insert Size 756
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001303239.1, NP_001290168.1
RefSeq Size 1218
RefSeq ORF 756
Locus ID 14276
Gene Summary This gene encodes a receptor protein located on the plasma membrane that mediates folate uptake by cells. Mice lacking the product of this gene show no defects in embryonic development and grow normally into fertile adults. However, such mice were found to be highly susceptible to the teratogenic effects of arsenic. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Transcript Variant: This variant (1) represents the longest transcript. All variants (1-3) encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.