Gnas (NM_019690) Mouse Untagged Clone

CAT#: MC226594

Gnas (untagged) - Mouse GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus (Gnas), transcript variant 4


  "NM_019690" in other vectors (1)

Reconstitution Protocol

USD 270.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Gnas"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Gnas
Synonyms 5530400H20Rik; A930027G11Rik; C130027O20Rik; Galphas; Gnas1; Gnasxl; GPSA; Gs-alpha; Gsa; GSP; Nesp; Nesp55; Nespl; Oed-Sml; Oedsml; P1; P2; P3; PHP1A; PHP1B; POH; SCG6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226594 representing NM_019690
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATCGCAGGTCCCGGGCTCAGCAGTGGCGCCGAGCTCGCCATAATTACAACGACCTGTGCCCGCCCA
TAGGCCGCCGGGCTGCCACCGCTCTCCTCTGGCTCTCCTGCTCCATTGCTCTCCTCCGCGCCCTAGCCTC
TTCCAACGCCCGCGCCCAGCAGCGTGCTGCCCAGCGCCGGAGCTTCCTTAACGCCCACCACCGCTCCGCT
GCCGCTGCAGCTGCCGCACAGGTACTCCCTGAGTCCTCTGAATCTGAGTCTGATCACGAGCACGAGGAGG
TTGAGCCTGAGCTGGCCCGCCCCGAGTGCCTAGAGTACGATCAGGACGACTACGAGACCGAGACCGATTC
TGAGACCGAGCCTGAGTCCGATATCGAATCCGAGACCGAAATCGAGACCGAGCCAGAGACCGAGCCAGAA
ACCGAGCCAGAGACCGAGCCAGAGGACGAGCGCGGCCCCCGGGGTGCCACCTTCAACCAGTCACTCACTC
AGCGTCTGCACGCTCTGAAGTTGCAGAGCGCCGACGCCTCCCCGAGACGTGCGCAGCCCACCACTCAGGA
GCCTGAGAGCGCAAGCGAGGGGGAGGAGCCCCAGCGAGGGCCCTTAGATCAGGATCCTCGGGACCCCGAG
GAGGAGCCAGAGGAGCGCAAGGAGGAAAACAGGCAGCCCCGCCGCTGCAAGACCAGGAGGCCAGCCCGCC
GTCGCGACCAGTCCCCGGAGTCCCCTCCCAGAAAGGGGCCCATCCCCATCCGGCGTCACTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_019690
ORF Size 762 bp
Insert Size 762
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_019690.3, NP_062664.2
RefSeq Size 1651
RefSeq ORF 762
Locus ID 14683
Gene Summary This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, which is commonly found in imprinted genes and correlates with transcript expression. This gene has an antisense transcript. One of the transcripts produced from this locus, and the antisense transcript, are both paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Additional transcript variants have been found for this gene, but the full-length nature and/or biological validity of some variants have not been determined. [provided by RefSeq, Jun 2015]
Transcript Variant: This variant (4) is maternally expressed. It lacks several 3' exons and has alternate 5' and 3' exons, compared to variant 7. Variants 3 and 4 both encode isoform secretogranin VI (SCG6, also known as NESP55), which localizes to large secretory vesicles of endocrine cells and neurons. The coding regions of variants 3 and 4 do not overlap the coding regions used by other transcripts; thus SCG6 has no similarity to isoforms of the G-protein alpha subunit. This variant has an antisense transcript NESPAS.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.