Gzmm (NM_001302485) Mouse Untagged Clone

CAT#: MC226662

Gzmm (untagged) - Mouse granzyme M (lymphocyte met-ase 1) (Gzmm), transcript variant 2


  "NM_001302485" in other vectors (1)

Reconstitution Protocol

USD 280.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Gzmm"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Gzmm
Synonyms Lmet1; MMET-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226662 representing NM_001302485
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGGTCTGCTGGTCCCTGCTGCTACTGCTGGCCCTGAAAACACTGTGGGCAGGCAACAGATTTGAGA
CCCAGATCATTGGGGGTCGAGAGGCAGTCCCGCACTCCCGCCCATACATGGCCTCTCTACAGAAAGCCAA
GTCCCATGTGTGTGGGGGAGTCCTTGTGCATCGGAAGTGGGTATTGACAGCTGCCCACTGCCTGTCTGAG
CCGCTACAGAACCTGAAGCTGGTGCTTGGCCTGCACAACCTCCATGATCTCCAAGATCCTGGCCTCACCT
TCTACATCCGGGAAGCCATTAAACACCCTGGCTACAACCACAAATATGAGAACGACCTGGCACTGCTTAA
GCTAGATAGACGAGTGCAGCCCAGCAAGAATGTCAAACCACTAGCTCTGCCAAGAAAGCCCCGATCCAAG
CCGGCAGAAGGTACCTGGTGCAGCACAGCTGGCTGGGGAATGACCCACCAGGGTGGGCCCCGGGCCAGGG
CCCTGCAGGAGTTGGATCTGCGTGTGCTGGATACCCAAATGTGTAACAACAGCCGCTTCTGGAACGGTGT
CCTCATAGACAGCATGCTATGCTTAAAGGCTGGGAGCAAGAGCCAAGCCCCCTGCAAGGGTGACTCTGGA
GGGCCCCTGGTGTGTGGCAAAGGCCAGGTGGATGGGATCCTGTCTTTCAGCTCCAAAACCTGCACAGACA
TCTTCAAGCCACCTGTGGCCACTGCTGTAGCCCCCTACAGCTCCTGGATCAGGAAGGTCATTGGTCGCTG
GTCACCCCAATCTTTGGTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001302485
ORF Size 792 bp
Insert Size 792
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001302485.1, NP_001289414.1
RefSeq Size 1301
RefSeq ORF 792
Locus ID 16904
Gene Summary The protein encoded by this gene is a member of a family of cytotoxic lymphocyte serine proteases called granzymes, which are expressed by cytotoxic T lymphocytes and natural killer cells. This protein belongs to a subfamily of granzymes that cleave after methionine residues. Natural killer cell development, homeostasis and cytotoxicity are normal in mice deficient for this gene, but they demonstrate increased susceptibility to murine cytomegalovirus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Transcript Variant: This variant (2) utilizes an alternate in-frame splice site in the 5' coding region. This results in a shorter protein (isoform 2), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.