Rad51d (NM_001277942) Mouse Untagged Clone

CAT#: MC226725

Rad51d (untagged) - Mouse RAD51 homolog D (Rad51d), transcript variant 5


  "NM_001277942" in other vectors (1)

Reconstitution Protocol

USD 290.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Rad51d"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rad51d
Synonyms R51H3; Rad51l3; TRAD; Trad-d5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226725 representing NM_001277942
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCATGCTCAGGGCAGGGCTGTGCCCGGGCCTCACCGAGGAGACCGTCCAGCTTCTCAGAGGCCGAA
AGATAAAAACAGTGGCAGACCTGGCAGCTGCTGACTTGGAGGAAGTAGCCCAGAAGTGTGGCTTGTCCTA
CAAGGCCCTCGTTGCCCTGAGGAGGGTGTTGCTGGCGCAGTTCTCGGCTTTCCCCTTAAATGGCGCAGAT
CTCTATGAGGAACTGAAGACTTCCACGGCCATCCTGTCCACCGGCATCGGAAGCCTGGACAAACTACTTG
ATGCTGGCCTCTATACTGGGGAGGTGACTGAAATTGTGGGTGGCCCAGGTAGCGGCAAAACCCAGGTGTG
TCTCTGTGTGGCTGCAAATGTGGCCCATAGCCTGCAGCAGAATGTACTGTATGTGGATTCCAATGGAGGA
ATGACGGCGTCCCGCCTCCTCCAGCTACTACAGGCTAGAACCCAAGATGAGGAGAAACAGGCAAGTGCTC
TCCAGAGGATACAGGTGGTGCGTTCATTTGACATCTTCCGGATGCTAGATATGCTACAGGACCTTCGCGG
CACCATAGCCCAGCAGGTGACCAACCACTTGACTCGAGATTGGGATGGTAGAAGATTCAAACCTGCCCTT
GGACGCTCCTGGAGCTTTGTGCCCAGTACCCGGATTCTCCTGGATGTCACTGAGGGGGCTGGGACACTCG
GTAGCAGCCAACGCACAGTATGTCTGACCAAGTCTCCCCGCCAGCCAACGGGTCTGCAGGAGATGATAGA
CATTGGGACATTGGGGACTGAGGAGCAGAGCCCAGAATTACCTGGCAAGCAGACGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001277942
ORF Size 828 bp
Insert Size 828
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001277942.1, NP_001264871.1
RefSeq Size 6910
RefSeq ORF 828
Locus ID 19364
Gene Summary This gene belongs to the Rad51 gene family whose products play a major role in homologous recombination and DNA repair. The encoded protein interacts with other proteins of this family, including Rad51b, Rad51c and Xrcc2, and plays an essential role in both DNA repair and telomere maintenance. In humans, germline mutations in this gene may be associated with predisposition to ovarian cancer. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
Transcript Variant: This variant (5, also known as Rad51d-delta7,8 or Trad-d3) lacks two alternate exons resulting in the loss of an in-frame segment in the 3' coding region compared to variant 1. It encodes isoform 5 which is shorter than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.