Sox17 (NM_001289467) Mouse Untagged Clone

CAT#: MC226835

Sox17 (untagged) - Mouse SRY (sex determining region Y)-box 17 (Sox17), transcript variant 5


  "NM_001289467" in other vectors (1)

Reconstitution Protocol

USD 300.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Sox17"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Sox17
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226835 representing NM_001289467
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGGACCACCCCAACTACAAGTACCGGCCGCGGCGGCGCAAGCAGGTGAAGCGCATGAAGCGGGTGG
AGGGAGGCTTCCTGCACGCTCTCGTCGAGCCCCAGGCCGGCGCGCTTGGTCCCGAGGGCGGCCGCGTGGC
CATGGATGGCCTGGGTCTGCCTTTCCCGGAGCCGGGCTATCCGGCCGGTCCTCCGCTGATGTCTCCGCAC
ATGGGCCCCCACTATCGGGACTGCCAGGGACTGGGCGCTCCCGCGCTCGACGGCTACCCTCTGCCCACTC
CGGACACATCCCCGCTGGATGGCGTGGAGCAGGACCCGGCTTTCTTTGCAGCCCCGCTGCCAGGGGACTG
CCCGGCGGCCGGCACCTACACTTACGCTCCAGTCTCGGACTATGCAGTGTCCGTAGAGCCGCCCGCTGGC
CCCATGCGAGTGGGGCCGGACCCCTCGGGCCCTGCGATGCCGGGGATCCTGGCGCCCCCCAGCGCTCTGC
ACCTGTACTACGGCGCGATGGGCTCGCCCGCCGCAAGTGCGGGGCGCGGTTTCCACGCGCAACCCCAGCA
GCCGCTGCAACCGCAGGCACCGCCGCCGCCACCGCAGCAGCAGCACCCAGCGCACGGCCCCGGGCAACCT
TCGCCCCCTCCCGAGGCTCTGCCCTGCCGGGATGGCACGGAATCCAACCAGCCCACTGAGCTCCTAGGGG
AGGTGGACCGCACGGAATTCGAACAGTATCTGCCCTTTGTGTATAAGCCCGAGATGGGTCTTCCCTACCA
GGGACACGACTGCGGAGTGAACCTCTCAGACAGCCACGGAGCCATTTCCTCCGTGGTGTCCGACGCTAGC
TCAGCGGTCTACTATTGCAACTACCCCGACATTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289467
ORF Size 876 bp
Insert Size 876
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001289467.1, NP_001276396.1
RefSeq Size 2897
RefSeq ORF 876
Locus ID 20671
Gene Summary This gene encodes a member of the Sox (Sry-related high mobility group box) family of transcription factors involved in the regulation of embryonic development. The encoded protein plays a role in the determination of cell fate and in maintaining cell identity. This gene regulates tumor angiogenesis and tumor progression. Mutations in the human gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (5) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream start codon compared to variant 1. The resulting isoform (c, also known as t-Sox17; PMID 8636240) has a shorter N-terminus compared to isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.