Zap70 (NM_001289612) Mouse Untagged Clone

CAT#: MC226959

Zap70 (untagged) - Mouse zeta-chain (TCR) associated protein kinase (Zap70), transcript variant 2


  "NM_001289612" in other vectors (1)

Reconstitution Protocol

USD 320.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Zap70"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Zap70
Synonyms mrtle; mur; Srk; ZAP-70
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226959 representing NM_001289612
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCCATGGACACAAGTGTGTACGAGAGTCCCTACAGCGACCCTGAGGAACTCAAAGACAAGAAGCTCT
TCCTGAAGCGAGAGAATCTCCTCGTGGCGGACATCGAGCTTGGCTGTGGCAACTTTGGCTCCGTGCGCCA
GGGAGTCTATCGCATGCGCAAGAAGCAGATTGACGTGGCCATCAAGGTGCTGAAGCAGGGCACAGAGAAG
GCCGACAAAGATGAGATGATGCGAGAGGCCCAGATCATGCACCAGCTCGACAACCCCTACATCGTGCGGC
TCATCGGCGTGTGCCAGGCAGAAGCACTCATGCTGGTCATGGAGATGGCGGGAGGCGGGCCCCTGCACAA
GTTCCTGCTGGGAAAGAAGGAGGAGATCCCTGTGAGCAATGTGGCTGAACTGCTGCACCAGGTGGCCATG
GGCATGAAGTATTTGGAGGAGAAAAACTTTGTGCACCGCGACCTGGCAGCCCGCAATGTTCTACTGGTCA
ATCGGCACTATGCCAAGATCAGCGACTTTGGCCTGTCCAAAGCCCTGGGTGCTGACGACAGCTATTACAC
AGCCCGGTCTGCAGGGAAGTGGCCTCTGAAGTGGTACGCGCCAGAGTGCATCAACTTTCGGAAGTTCTCC
AGCCGCAGTGACGTCTGGAGCTATGGGGTCACCATGTGGGAGGCCTTCTCCTATGGCCAGAAGCCCTACA
AGAAAATGAAGGGCCCCGAGGTCCTGGACTTCATCAAGCAGGGTAAGAGGATGGAATGTCCGCCGGAGTG
TCCTCCTGAGATGTATGCACTTATGAGTGACTGCTGGATCTACAAGTGGGAGGATCGCCCCGACTTCCTG
ACTGTGGAACAACGTATGCGGAACTATTACTACAGCCTGGCCAGCCGGGCCGAGGGACCCCCACAGTGTG
AACAGGTGGCCGAGGCTGCATGTGGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289612
ORF Size 939 bp
Insert Size 939
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001289612.1, NP_001276541.1
RefSeq Size 1343
RefSeq ORF 939
Locus ID 22637
Gene Summary This gene encodes a member of the protein tyrosine kinase family. The encoded protein is essential for development of T lymphocytes and thymocytes, and functions in the initial step of T lymphocyte receptor-mediated signal transduction. A mutation in this gene causes chronic autoimmune arthritis, similar to rheumatoid arthritis in humans. Mice lacking this gene are deficient in alpha-beta T lymphocytes in the thymus. In humans, mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T lymphocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (2) contains a 5' terminal exon that extends past a splice site that is used in variant 1. This variant differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream start codon compared to variant 4. The encoded isoform (TZK, also known as truncated ZAP kinase; PMID 14985102) has a shorter N-terminus compared to isoform b. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.