Cops5 (NM_001277101) Mouse Untagged Clone

CAT#: MC226994

Cops5 (untagged) - Mouse COP9 (constitutive photomorphogenic) homolog, subunit 5 (Arabidopsis thaliana) (Cops5), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cops5
• Synonyms: AI303502; CSN5; Jab1; Mov34; Sgn5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226994 representing NM_001277101
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCGCTGCGCCGCCGCCGCGCCCCAGCGCGCGAATGGTCTGGACCAACGTCACCTCCGGTCTCAAGTG
  TCATGGCTGCCTTGAGAGTCTATCACCACTACTTTAAATACTGCAAAATCTCAGCATTGGCTCTACTGAA
  AATGGTGATGCATGCCAGGTCAGGAGGCAACTTGGAAGTGATGGGTTTGATGCTCGGGAAAGTCGACGGC
  GAGACCATGATCATCATGGACAGTTTCGCTTTGCCTGTAGAGGGCACAGAAACTCGAGTAAATGCTCAAG
  CTGCTGCGTATGAGTATATGGCTGCATACATAGAAAATGCCAAACAGGTTGGCCGCCTTGAGAATGCAAT
  CGGTTGGTATCATAGCCACCCTGGTTATGGCTGCTGGCTCTCCGGGATTGATGTTAGTACACAGATGCTG
  AACCAGCAGTTTCAAGAACCATTTGTAGCAGTGGTGATTGATCCAACCAGAACAATCTCTGCAGGAAAAG
  TGAATCTTGGCGCCTTTAGGACATATCCAAAGGGCTACAAACCTCCTGATGAAGGACCTTCTGAGTACCA
  GACTATCCCACTTAATAAAATAGAAGATTTTGGCGTGCACTGCAAACAATATTATGCCTTAGAAGTCTCA
  TATTTCAAATCATCTTTGGATCGTAAACTACTTGAGCTTTTGTGGAATAAATACTGGGTGAATACCCTGA
  GTTCCTCTAGCTTGCTTACTAATGCAGACTACACCACAGGCCAGGTGTTTGATTTGTCTGAGAAGTTAGA
  GCAGTCGGAAGCCCAACTGGGACGTGGCAGTTTCATGTTGGGCTTAGAAACACATGACCGCAAGTCGGAA
  GACAAACTTGCCAAAGCTACTAGAGACAGCTGTAAAACCACCATAGAAGCCATCCATGGACTGATGTCTC
  AGGTTATTAAGGATAAACTGTTTAATCAGATTAACGTTGCTTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001277101
• ORF Size: 954 bp
• Insert Size: 954
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001277101.1, NP_001264030.1
• RefSeq Size: 1482
• RefSeq ORF: 954
• Locus ID: 26754
• Gene Summary: Probable protease subunit of the COP9 signalosome complex (CSN), a complex involved in various cellular and developmental processes. The CSN complex is an essential regulator of the ubiquitin (Ubl) conjugation pathway by mediating the deneddylation of the cullin subunits of the SCF-type E3 ligase complexes, leading to decrease the Ubl ligase activity of SCF-type complexes such as SCF, CSA or DDB2. Promotes the proteasomal degradation of BRSK2. The complex is also involved in phosphorylation of p53/TP53, c-jun/JUN, IkappaBalpha/NFKBIA, ITPK1 and IRF8, possibly via its association with CK2 and PKD kinases. CSN-dependent phosphorylation of TP53 and JUN promotes and protects degradation by the Ubl system, respectively. In the complex, it probably acts as the catalytic center that mediates the cleavage of Nedd8 from cullins. It however has no metalloprotease activity by itself and requires the other subunits of the CSN complex. Interacts directly with a large number of proteins that are regulated by the CSN complex, confirming a key role in the complex. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) is shorter and has a distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.