Fut1 (NM_001271981) Mouse Untagged Clone

CAT#: MC227027

Fut1 (untagged) - Mouse fucosyltransferase 1 (Fut1), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Fut1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC227027 representing NM_001271981
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGTATGCCTACCTCATCCATTGCAGACATCTAATGGCTCCCCTTCCTGTCCTGAGCAGTCCTCCTCAC
  TCTCTGGGACTTGGACAATCACCCCAGGAGGCAGGTTTGGTAACCAGATGGGGCAGTATGCTACATTGCT
  GGCCCTAGCCCAGCTCAATGGTCGCCAAGCCTTCATCCAACCTGAGATGCATGCCGCCCTGGCCCCCGTG
  TTCCGAATCTCCCTGCCAGTGCTGGACCCTGAGGTGGACAGCCTCACACCTTGGCAGCACTTAGTCCTAC
  ATGACTGGATGTCAGAGGAGTACTCCCATCTGGAGGACCCATTTCTCAAGCTGTCTGGTTTCCCCTGCTC
  TTGGACCTTTTTCCATCATCTTCGGGAACAGATTCGTAGGGAATTCACTCTGCATAACCATCTACGGGAA
  GGTGCCCAGTACCTGTTGAGCGGGCTCCGTATAGGCCCGGCGGGCATCCGCCCTCATACCTTTGTGGGTG
  TCCATGTGCGTCGTGGAGACTATCTGGAGGTGATGCCCAATCGCTGGAAGGGTGTGGTGGGTGACCGAGC
  TTACCTCCAGCAAGCCATGGACTGGTTCCGGGCCCGACACAAAGACCCCATCTTTGTGGTCACCAGCAAT
  GGCATGAAATGGTGTTTGGAGAACATTGACACATCCCATGGTGATGTGGTCTTCGCTGGCAATGGACAGG
  AGGGTACACCGGGGAAGGACTTTGCACTTCTCACACAGTGTAACCACACCATCATGACTATTGGCACCTT
  TGGCTTCTGGGCTGCCTACTTAGCTGGTGGAGACACGGTCTACCTTGCAAACTTCACCCTGCCAGATTCG
  GAGTTTCTGAAGATCTTCAGGCCTGAGGCTGCCTTCCTGCCTGAGTGGGTGGGCATCAATGCAGACTTGT
  CCCCGCTGCAGGCTCAATTTGACCCCTGGAAGCCAGACAGTCTTTTTAGATTGGTCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271981
• ORF Size: 969 bp
• Insert Size: 969
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001271981.1, NP_001258910.1
• RefSeq Size: 2442
• RefSeq ORF: 969
• Locus ID: 14343
• Gene Summary: This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is required for the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene impairs development of the olfactory nerve and maturation of the glomerular layer of the main olfactory bulb. Alternative splicing results in multiple transcript variants which encode distinct isoforms. [provided by RefSeq, Dec 2012]
  Transcript Variant: This variant (2) uses an alternate splice site at the 5' end of the coding exon and uses an in-frame downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript from the same strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments and orthologous data.