Azin1 (NM_001301688) Mouse Untagged Clone

CAT#: MC227288

Azin1 (untagged) - Mouse antizyme inhibitor 1 (Azin1), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Azin1
• Synonyms: 1700085L02Rik; AZI; Oazi; Oazin
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC227288 representing NM_001301688
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAAAGGATTTATTGACGATGCGAACTACTCCGTTGGCCTGTTGGATGAAGGAACAAACCTTGGAAATG
  TTATTGATAACTATGTTTATGAACATACCCTGACAGGAAAAAATGCATTTTTTGTGGGGGATCTTGGGAA
  GATCGTGAAGAAGCACAGTCAGTGGCAGACCGTGGTGGCTCAGATAAAGCCGTTTTACACGGTGAAGTGC
  AACTCCACTCCAGCCGTGCTTGAGATCTTGGCAGCTCTTGGAACTGGGTTTGCTTGTTCCAGCAAAAATG
  AAATGGCTTTAGTGCAAGAATTGGGTGTATCTCCAGAAAACATCATTTTCACAAGTCCTTGTAAGCAAGT
  GTCTCAGATAAAGTATGCAGCAAAAGTTGGAGTAAATATTATGACATGTGACAATGAGATTGAATTAAAG
  AAAATTGCAAGGAATCACCCAAATGCCAAGGTCTTACTACATATTGCAACAGAAGATAATATTGGAGGTG
  AAGATGGTAACATGAAGTTTGGCACTACACTGAAGAATTGTAGGCATCTTTTGGAATGTGCCAAGGAACT
  TGATGTCCAAATAATTGGGGTTAAATTTCATGTTTCAAGTGCTTGCAAAGAATATCAAGTATATGTACAT
  GCCCTGTCTGATGCTCGATGTGTGTTTGACATGGCTGGAGAGTTTGGCTTTACAATGAACATGTTAGACA
  TCGGTGGAGGCTTCACAGGAACTGAAATTCAGTTGGAAGAGGTTAATCATGTTATCAGTCCTCTGTTGGA
  TATTTACTTCCCTGAAGGATCTGGCATTCAGATAATTTCAGAACCTGGAAGCTACTATGTATCTTCTGCG
  TTTACACTTGCAGTCAATATTATTGCTAAGAAAGTTGTTGAAAATGATAAATTTTCCTCTGGAGTAGAAA
  AAAATGGGAGTGATGAGCCAGCCTTCGTGTATTACATGAATGATGGTGTTTATGGTTCTTTTGCGAGTAA
  GCTTTCTGAGGACTTAAATACCATTCCAGAGGTTCACAAGAAATACAAGGAAGATGAGCCTCTGTTTACA
  AGCAGCCTTTGGGGTCCATCCTGTGATGAGCTTTTCCACTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301688
• ORF Size: 1092 bp
• Insert Size: 1092
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001301688.1, NP_001288617.1
• RefSeq Size: 4620
• RefSeq ORF: 1092
• Locus ID: 54375
• Gene Summary: The protein encoded by this gene belongs to the antizyme inhibitor family, which plays a role in cell growth and proliferation by maintaining polyamine homeostasis within the cell. Antizyme inhibitors are homologs of ornithine decarboxylase (ODC, the key enzyme in polyamine biosynthesis) that have lost the ability to decarboxylase ornithine; however, retain the ability to bind to antizymes. Antizymes negatively regulate intracellular polyamine levels by binding to ODC and targeting it for degradation, as well as by inhibiting polyamine uptake. Antizyme inhibitors function as positive regulators of polyamine levels by sequestering antizymes and neutralizing their effect. This gene encodes antizyme inhibitor 1, the first member of this gene family that is ubiquitously expressed, and is localized in the nucleus and cytoplasm. Overexpression of antizyme inhibitor 1 gene has been associated with increased proliferation, cellular transformation and tumorigenesis. Gene knockout studies showed that homozygous mutant mice lacking functional antizyme inhibitor 1 gene died at birth with abnormal liver morphology. RNA editing of this gene, predominantly in the liver tissue, has been linked to the progression of hepatocellular carcinoma. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Sep 2014]
  Transcript Variant: This variant (3) is alternatively spliced in the 3' coding region, which causes a frame-shift, compared to variant 1. The resulting isoform (2) is shorter with a distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.