Fndc5 (NM_027402) Mouse Tagged ORF Clone
CAT#: MR216114
- TrueORF®
Fndc5 (Myc-DDK-tagged) - Mouse fibronectin type III domain containing 5 (Fndc5)
"NM_027402" in other vectors (6)
Interest in protein/lysate? Submit request here!
Product Images
Specifications
Product Data | |
Type | Mouse Tagged ORF Clone |
Tag | Myc-DDK |
Symbol | Fndc5 |
Synonyms | 1500001L03Rik; AI836596; C87088; PeP; Pxp |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MR216114 representing NM_027402
Red=Cloning site Blue=ORF Green=Tags(s) CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCCCCAGGGCCGTGCGCCTGGCCGCCCCGCGCCGCGCTCCGCCTGTGGCTAGGCTGCGTCTGCTTCG CGCTGGTGCAGGCGGACAGCCCCTCAGCCCCTGTGAACGTGACCGTCCGGCACCTCAAGGCCAACTCTGC CGTGGTCAGCTGGGATGTCCTGGAGGATGAAGTGGTCATTGGCTTTGCCATCTCTCAGCAGAAGAAGGAT GTGCGGATGCTCCGGTTCATTCAGGAGGTGAACACCACCACCCGGTCCTGCGCTCTCTGGGACCTGGAGG AGGACACAGAATATATCGTCCATGTGCAGGCCATCTCCATCCAGGGACAGAGCCCAGCCAGTGAGCCTGT GCTCTTCAAGACCCCACGCGAGGCTGAAAAGATGGCCTCAAAGAACAAAGATGAGGTGACCATGAAGGAG ATGGGGAGGAACCAGCAGCTGCGAACGGGGGAGGTGCTGATCATTGTTGTGGTCCTCTTCATGTGGGCAG GTGTTATAGCTCTCTTCTGCCGCCAGTATGATATCATCAAGGACAACGAGCCCAATAACAACAAGGAGAA AACCAAGAGCGCATCAGAAACCAGCACACCGGAGCATCAGGGTGGGGGTCTCCTCCGCAGCAAGATA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI Cloning Scheme for this gene Plasmid Map |
ACCN | NM_027402 |
ORF Size | 627 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
Reference Data | |
RefSeq | NM_027402.1, NM_027402.2, NM_027402.3, NM_027402.4, NP_081678.1 |
RefSeq Size | 2718 |
RefSeq ORF | 630 |
Locus ID | 384061 |
MW | 23.8 kDa |
Gene Summary | This gene encodes a type I transmembrane protein containing fibronectin type III repeat. The encoded transmembrane protein undergoes proteolytic processing to generate a soluble hormone named irisin that is secreted into the bloodstream. The expression of this gene followed by the secretion of irisin from skeletal muscle is induced by exercise. The ectopic expression of the encoded protein in mice causes an elevation of irisin in blood and improves metabolic health. [provided by RefSeq, Jul 2016] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC214786 | Fndc5 (untagged) - Mouse fibronectin type III domain containing 5 (Fndc5), (10ug) |
USD 420.00 |
|
MG216114 | Fndc5 (GFP-tagged) - Mouse fibronectin type III domain containing 5 (Fndc5), (10ug) |
USD 460.00 |
|
MR216114L1 | Lenti ORF clone of Fndc5 (Myc-DDK-tagged) - Mouse fibronectin type III domain containing 5 (Fndc5) |
USD 768.00 |
|
MR216114L2 | Lenti ORF clone of Fndc5 (mGFP-tagged) - Mouse fibronectin type III domain containing 5 (Fndc5) |
USD 620.00 |
|
MR216114L3 | Lenti ORF clone of Fndc5 (Myc-DDK-tagged) - Mouse fibronectin type III domain containing 5 (Fndc5) |
USD 620.00 |
|
MR216114L4 | Lenti ORF clone of Fndc5 (mGFP-tagged) - Mouse fibronectin type III domain containing 5 (Fndc5) |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review