C1orf124 (SPRTN) (NM_001010984) Human Tagged ORF Clone

CAT#: RG218238

SPRTN (GFP-tagged) - Human chromosome 1 open reading frame 124 (C1orf124), transcript variant 2

Specifications

Product Data

• Type: Human Tagged ORF Clone
• Tag: TurboGFP
• Symbol: SPRTN
• Synonyms: C1orf124; DVC1; PRO4323; spartan
• Vector: pCMV6-AC-GFP
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  ORF Nucleotide Sequence

  >RG218238 representing NM_001010984
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGATGATGACTTGATGTTGGCACTGCGGCTTCAGGAGGAGTGGAACTTGCAGGAGGCGGAGCGCGATC
  ATGCCCAGGAGTCCCTGTCGCTAGTGG
  
  ACGCGTACGCGGCCGCTCGAG - GFP Tag - GTTTAA
  Protein Sequence

  >RG218238 representing NM_001010984
  Red=Cloning site Green=Tags(s)
  
  MDDDLMLALRLQEEWNLQEAERDHAQESLSLV
  
  TRTRRLE - GFP Tag - V
• Restriction Sites: SgfI-MluI Cloning Scheme for this gene Plasmid Map
• ACCN: NM_001010984
• ORF Size: 750 bp
• OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene.

Reference Data

• RefSeq: NM_001010984.1, NP_001010984.1
• RefSeq Size: 3854
• RefSeq ORF: 753
• Locus ID: 83932
• Protein Families: Druggable Genome
• Gene Summary: The protein encoded by this gene may play a role in DNA repair during replication of damaged DNA. This protein recruits valosin containing protein (p97) to stalled DNA replication forks where it may prevent excessive translesional DNA synthesis and limit the number of DNA-damage induced mutations. It may also be involved in replication-related G2/M-checkpoint regulation. Deficiency of a similar protein in mouse causes chromosomal instability and progeroid phenotypes. Mutations in this gene have been associated with Ruijs-Aalfs syndrome (RJALS). Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]