MCP2 (CCL8) (NM_005623) Human Tagged ORF Clone

CAT#: RG221610

CCL8 (GFP-tagged) - Human chemokine (C-C motif) ligand 8 (CCL8)

Specifications

Product Data

• Type: Human Tagged ORF Clone
• Tag: TurboGFP
• Symbol: CCL8
• Synonyms: HC14; MCP-2; MCP2; SCYA8; SCYA10
• Vector: pCMV6-AC-GFP
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  ORF Nucleotide Sequence

  >RG221610 representing NM_005623
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAAGGTTTCTGCAGCGCTTCTGTGCCTGCTGCTCATGGCAGCCACTTTCAGCCCTCAGGGACTTGCTC
  AGCCAGATTCAGTTTCCATTCCAATCACCTGCTGCTTTAACGTGATCAATAGGAAAATTCCTATCCAGAG
  GCTGGAGAGCTACACAAGAATCACCAACATCCAATGTCCCAAGGAAGCTGTGATCTTCAAGACCCAACGG
  GGCAAGGAGGTCTGTGCTGACCCCAAGGAGAGATGGGTCAGGGATTCCATGAAGCATCTGGACCAAATAT
  TTCAAAATCTGAAGCCA
  
  ACGCGTACGCGGCCGCTCGAG - GFP Tag - GTTTAA
  Protein Sequence

  >RG221610 representing NM_005623
  Red=Cloning site Green=Tags(s)
  
  MKVSAALLCLLLMAATFSPQGLAQPDSVSIPITCCFNVINRKIPIQRLESYTRITNIQCPKEAVIFKTQR
  GKEVCADPKERWVRDSMKHLDQIFQNLKP
  
  TRTRPLE - GFP Tag - V
• Restriction Sites: SgfI-MluI Cloning Scheme for this gene Plasmid Map
• ACCN: NM_005623
• ORF Size: 297 bp
• OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene.
• Product Components: The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_005623.2, NP_005614.2
• RefSeq Size: 1351 bp
• RefSeq ORF: 300 bp
• Locus ID: 6355
• Cytogenetics: 17q12
• Domains: IL8
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Chemokine signaling pathway, Cytokine-cytokine receptor interaction, NOD-like receptor signaling pathway
• Gene Summary: 'This antimicrobial gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of N-terminal cysteine residues of the mature peptide. This chemokine is a member of the CC subfamily which is characterized by two adjacent cysteine residues. This cytokine displays chemotactic activity for monocytes, lymphocytes, basophils and eosinophils. By recruiting leukocytes to sites of inflammation this cytokine may contribute to tumor-associated leukocyte infiltration and to the antiviral state against HIV infection. [provided by RefSeq, Sep 2014]'