Ost4 (NM_001134690) Rat Untagged Clone

CAT#: RN200006

LOC100188932 (untagged ORF) - Rat dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit 4 (LOC100188932), transcript variant 2, (10 ug)


  "NM_001134690" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Ost4"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Ost4
Synonyms Ost4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN200006 representing NM_001134690
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATCACGGACGTGCAGCTCGCCATCTTCGCCAACATGCTGGGCGTGTCGCTTTTCTTGCTTGTGGTCC
TCTATCACTACGTGGCAGTAAATAACCCCAAGAAGCAGGAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001134690
ORF Size 114 bp
Insert Size 114
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001134690.1, NP_001128162.1
RefSeq Size 570
RefSeq ORF 114
Locus ID 100188932

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.