Tmub1 (NM_198781) Rat Untagged Clone

CAT#: RN200056

Tmub1 (untagged ORF) - Rat transmembrane and ubiquitin-like domain containing 1 (Tmub1), transcript variant 1, (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Tmub1
• Synonyms: Hops
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN200056 representing NM_198781
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCTTGATTGAAGGCGTAGGGGATGAGGTGACTGTCCTTTTTTCGGTGCTTGCCTGCCTTCTGGTGC
  TGGCCCTCGCCTGGGTCTCAACACATACGACTGAGAGTACAGATCCCCTACCACAGTCGTCAGGGACCAC
  AACACCAGCACAGCCCAGTGAAGCCATGACAGCCATTGATAGCATCAGAGAGGAGGCCCCAGGAGCTGAG
  AGTCCCAGCCTGAGGCACAGAGGTCCATCTGCACAGCCAGAGCCTGAGGCAGGGGTCACAGCATCAACAC
  CTCCAGACTCTCCACAGGAACCCTTACTGCTACGGTTGAAATTTCTCAATGACTCTGAACAGGTGGCCAG
  GGCCTGGCCTCAGGACACCATTGGCTCCTTGAAAAGAACCCAGTTTCCAGGCCGGGAACAGCAGGTTCGA
  CTCATCTACCAAGGCCAACTGCTAGGAGACGACACCCAGACACTGGGCAGTCTCCACCTTCCCCCCAACT
  GCGTTCTCCACTGCCACGTGTCCACAAGAGTCGGTCCCCCGCATCCTCCCTGCCCACCGGGGTCAGAGCC
  CGGCCCCTCCGGGCTGGAAATCGGCAGCCTTCTGTTGCCCCTGCTGCTTCTGCTGCTGCTCCTGCTCTGG
  TACTGCCAGATCCAGTACCGGCCCTTCTTTCCCCTGACCGCTACCTTGGGCCTGGCCGGCTTCACCCTGC
  TCCTCAGTCTCCTGGCCTTTGCCATGTATCGCCCGTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_198781
• ORF Size: 738 bp
• Insert Size: 738
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_198781.3, NP_942076.2
• RefSeq Size: 1284
• RefSeq ORF: 738
• Locus ID: 362301
• Gene Summary: The protein encoded by this gene belongs to a group of integral ubiquitin-like domain containing proteins that are involved in a range of cellular processes. In mouse, the protein exists in uncleaved transmembrane forms as well as a cleaved form that shuttles between the nucleus and cytoplasm. During liver regeneration in rat, it has been shown that the protein shuttles from the cytoplasm to the nucleus to inhibit hepatocyte proliferation. Homozygous null mutant mice display normal development and physiology but exhibit a strong increase in locomoter activity during the dark phase of the light:dark cycle, indicating a function in behavioral regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
  Transcript Variant: This variant (1) uses an alternate exon in the 5' UTR compared to variant 2. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.