Tmub1 (NM_001080153) Rat Untagged Clone

CAT#: RN200057

Tmub1 (untagged ORF) - Rat transmembrane and ubiquitin-like domain containing 1 (Tmub1), transcript variant 2, (10 ug)


  "NM_001080153" in other vectors (3)

Reconstitution Protocol

USD 420.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "Tmub1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Tmub1
Synonyms Hops
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN200057 representing NM_001080153
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCTTGATTGAAGGCGTAGGGGATGAGGTGACTGTCCTTTTTTCGGTGCTTGCCTGCCTTCTGGTGC
TGGCCCTCGCCTGGGTCTCAACACATACGACTGAGAGTACAGATCCCCTACCACAGTCGTCAGGGACCAC
AACACCAGCACAGCCCAGTGAAGCCATGACAGCCATTGATAGCATCAGAGAGGAGGCCCCAGGAGCTGAG
AGTCCCAGCCTGAGGCACAGAGGTCCATCTGCACAGCCAGAGCCTGAGGCAGGGGTCACAGCATCAACAC
CTCCAGACTCTCCACAGGAACCCTTACTGCTACGGTTGAAATTTCTCAATGACTCTGAACAGGTGGCCAG
GGCCTGGCCTCAGGACACCATTGGCTCCTTGAAAAGAACCCAGTTTCCAGGCCGGGAACAGCAGGTTCGA
CTCATCTACCAAGGCCAACTGCTAGGAGACGACACCCAGACACTGGGCAGTCTCCACCTTCCCCCCAACT
GCGTTCTCCACTGCCACGTGTCCACAAGAGTCGGTCCCCCGCATCCTCCCTGCCCACCGGGGTCAGAGCC
CGGCCCCTCCGGGCTGGAAATCGGCAGCCTTCTGTTGCCCCTGCTGCTTCTGCTGCTGCTCCTGCTCTGG
TACTGCCAGATCCAGTACCGGCCCTTCTTTCCCCTGACCGCTACCTTGGGCCTGGCCGGCTTCACCCTGC
TCCTCAGTCTCCTGGCCTTTGCCATGTATCGCCCGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001080153
ORF Size 738 bp
Insert Size 738
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001080153.2, NP_001073622.1
RefSeq Size 1374
RefSeq ORF 738
Locus ID 362301
Gene Summary The protein encoded by this gene belongs to a group of integral ubiquitin-like domain containing proteins that are involved in a range of cellular processes. In mouse, the protein exists in uncleaved transmembrane forms as well as a cleaved form that shuttles between the nucleus and cytoplasm. During liver regeneration in rat, it has been shown that the protein shuttles from the cytoplasm to the nucleus to inhibit hepatocyte proliferation. Homozygous null mutant mice display normal development and physiology but exhibit a strong increase in locomoter activity during the dark phase of the light:dark cycle, indicating a function in behavioral regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
Transcript Variant: This variant (2) represents the longer transcript. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.