Tmem14c (NM_134395) Rat Untagged Clone

CAT#: RN200186

Tmem14c (untagged ORF) - Rat transmembrane protein 14C (Tmem14c), transcript variant 1, (10 ug)


  "NM_134395" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Tmem14c"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Tmem14c
Synonyms Cdtw1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN200186 representing NM_134395
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGAAGGACAGTGGCCCACTGGTTCCTTTACATTATTATGGTTTCGGCTATGCGGCCCTGGTGGCTA
CTGGTGGGATTATTGGCTATGCAAAAGCAGGTAGTGTGCCGTCCCTGGCTGCTGGACTCTTCTTTGGGGG
CCTGGCAGGCCTGGGTGCCTACCAGCTGTCTCAGGACCCCAGGAACGTGTGGGTTTTCCTAGCTACGTCT
GGGACTTTGGCTGGCATTATGGGGATGAGATTCTACAACTCTGGGAAATTTATGCCTGCAGGTTTGATCG
CGGGAGCCAGTTTGCTGATGGTTGCCAAACTTGGACTTAGTATGTTGAGTTCACCCCATCCATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_134395
ORF Size 345 bp
Insert Size 345
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_134395.2, NP_599222.2
RefSeq Size 1086
RefSeq ORF 345
Locus ID 171432
Gene Summary expression is upregulated in response to stroke [RGD, Feb 2006]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.