Reg3a (NM_001145846) Rat Untagged Clone

CAT#: RN200187

Reg3a (untagged ORF) - Rat regenerating islet-derived 3 alpha (Reg3a), transcript variant 2, (10 ug)


  "NM_001145846" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Reg3a"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Reg3a
Synonyms Pap2; PapII
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN200187 representing NM_001145846
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTGCCTCGTCTGTCCTTCAACAATGTGTCCTGGACGCTGCTCTACTACCTGTTCATATTTCAGGTAC
GAGGTGAAGACTCCCAGAAGGCAGTGCCCTCTACACGAACCAGCTGCCCCATGGGCTCCAAGGCTTATCG
TTCTTACTGCTATACCTTGGTCACGACACTCAAATCCTGGTTTCAAGCAGATCTGGCCTGCCAGAAGAGA
CCTTCAGGACACCTTGTGTCTATTCTTAGTGGAGGTGAGGCTTCCTTTGTGTCTTCCCTGGTGACAGGCA
GAGTGAACAACAACCAAGACATCTGGATTGGGCTCCATGATCCAACAATGGGTCAACAACCCAATGGAGG
TGGATGGGAGTGGAGTAACTCTGACGTACTGAATTATCTCAACTGGGATGGGGATCCTTCCTCTACTGTC
AACCGTGGTAACTGTGGCAGTCTAACAGCTACCTCGGAGTTTCTGAAGTGGGGAGACCATCACTGTGATG
TGGAATTACCTTTTGTCTGCAAGTTCAAGCAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001145846
ORF Size 525 bp
Insert Size 525
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001145846.2, NP_001139318.1
RefSeq Size 805
RefSeq ORF 525
Locus ID 171162
Gene Summary lectin-related secretory protein; overexpressed during the acute phase of pancreatitis [RGD, Feb 2006]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.