Rtn3 (NM_001009953) Rat Untagged Clone
CAT#: RN200210
Rtn3 (untagged ORF) - Rat reticulon 3 (Rtn3), transcript variant 2, (10 ug)
"NM_001009953" in other vectors (3)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Symbol | Rtn3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN200210 representing NM_001009953
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGAGTCATCGGCGGCCACTCAGTCTCCGTCAGTCTCCTCGTCGTCCTCCGGGGCCGAGCCGTCAA CGCTTGGCGGCGGCGGCGGGAGCCCTGGAGCCTGCCCCGCCCTGGGGGCGAAGAGCTGCGGCTCCTCCTG TGCGGTGCATGATCTGATTTTCTGGCGAGATGTGAAGAAGACTGGGTTTGTCTTTGGCACCACGCTGATC ATGCTGCTCTCTCTGGCAGCTTTCAGTGTTATCAGTGTGGTCTCTTACCTCATCCTGGCTCTACTCTCTG TCACCATCAGCTTCAGAGTCTACAAGTCTGTCATCCAAGCTGTGCAGAAGTCAGAAGAAGGACATCCATT CAAGGCCTACCTGGATGTGGACATTACACTGTCCTCAGAAGCTTTCCACAGCTACATGAATGCTGCAATG GTGCATGTCAACAAGGCCCTCAAACTCATTATTCGTCTCTTTCTGGTAGAAGACTTGGTTGACTCCTTGA AGCTGGCTGTCTTCATGTGGCTGATGACCTACGTCGGTGCTGTTTTTAACGGAATTACCCTTCTGATTCT CGCCGAGCTGCTGGTTTTCAGCGTCCCAATTGTCTATGAGAAGTATAAGACACAGATTGACCACTATGTT GGGATTGCCCGGGATCAGACCAAGTCAATTGTTGAAAAGATCCAAGCAAAGCTTCCTGGAATCGCCAAAA AAAAGGCAGAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001009953 |
Insert Size | 714 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001009953.3, NP_001009953.2 |
RefSeq Size | 2817 bp |
RefSeq ORF | 714 bp |
Locus ID | 140945 |
Cytogenetics | 1q43 |
Gene Summary | This gene encodes a member of the reticulon family, a large group of membrane-bound proteins that primarily localize to the endoplasmic reticulum with a small subpopulation at the cell surface. These proteins play roles in endocytosis, exocytosis, trafficking and neuronal outgrowth. Proteins belonging to this family are characterized by a carboxy-terminal reticulon homology domain that consists of a small hydrophilic loop flanked by hydrophobic regions. In rat, this protein has been shown to interact with two members of the synaptic adhesion-like molecule family, suggesting that it may function in trafficking of these proteins. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015] Transcript Variant: This variant (2) lacks an internal in-frame exon compared to variant 1. It encodes isoform A1, which is shorter than isoform A. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript from the same strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR200210 | Rtn3 (Myc-DDK-tagged ORF) - Rat reticulon 3 (Rtn3), transcript variant 2, (10 ug) |
USD 420.00 |
|
RR200210L3 | Lenti ORF clone of Rtn3 (Myc-DDK-tagged ORF) - Rat reticulon 3 (Rtn3), transcript variant 2, (10 ug) |
USD 640.00 |
|
RR200210L4 | Lenti ORF clone of Rtn3 (mGFP-tagged ORF) - Rat reticulon 3 (Rtn3), transcript variant 2, (10 ug) |
USD 700.00 |
{0} Product Review(s)
Be the first one to submit a review