Slc15a1 (NM_001079838) Rat Untagged Clone

CAT#: RN200222

Slc15a1 (untagged ORF) - Rat solute carrier family 15 (oligopeptide transporter), member 1 (Slc15a1), transcript variant 2, (10 ug)


  "NM_001079838" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Slc15a1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Slc15a1
Synonyms Pept1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN200222 representing NM_001079838
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTCCAGAGTGATGGCTGCCTGGAAGTGAAGGAATTCGAAGACATCCCACCCAACACGGTGAACATGG
CCCTGCAGATCCCACAGTACTTCCTCCTCACCTGCGGCGAGGTGGTCTTCTCTGTCACAGGACTGGAGTT
CTCCTATTCCCAGGCCCCGTCTAACATGAAGTCCGTGCTTCAGGCAGGATGGCTTCTAACCGTGGCCATC
GGTAATATCATTGTCCTCATTGTGGCTGAGGCAGGCCACTTCGACAAACAGTGGGCTGAGTATGTTCTGT
TCGCCTCCTTGCTCCTGGTCGTCTGCATCATATTTGCCATTATGGCCCGATTCTACACCTACATCAACCC
AGCAGAGATCGAGGCACAGTTCGATGAGGATGAGAAGAAAAAGGGCGTAGGGAAGGAAAACCCGTATTCC
TCGTTGGAACCTGTCTCACAGACAAACATGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001079838
ORF Size 453 bp
Insert Size 453
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001079838.1, NP_001073307.1
RefSeq Size 626
RefSeq ORF 453
Locus ID 117261
Gene Summary acts as a proton dependent peptide transporter; may transport oral beta-lactam antibiotics across intestinal brush borders [RGD, Feb 2006]
Transcript Variant: This variant (2) lacks alternate exons in the 5' UTR and 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (pgPepT1) has a distinct N-terminus and is shorter than isoform PepT1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.