Ndufv3 (NM_001101011) Rat Untagged Clone

CAT#: RN200316

Ndufv3 (untagged ORF) - Rat NADH dehydrogenase (ubiquinone) flavoprotein 3 (Ndufv3), nuclear gene encoding mitochondrial protein, transcript variant 2, (10 ug)


  "NM_001101011" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Ndufv3"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Ndufv3
Synonyms Mipp65; Ndufv3l
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN200316 representing NM_001101011
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGTCTCTCTCCTGCTGCGGGGAGGACGAATCCGGGCGCTGAAGGCTGCCCTTCTCGAGGCAAAGG
TGTTCCGAGGAGAACTGGCTTCTACAGTGCCCCTGTCTACAGAGTCCGAGAATAATAAAAAGGCGGCAGG
ACCAACTAGCAAGACGGAAAGTGTGTTCAAAGAGCCCACACTGGTTCCCGAGTCGAGTGACACCACCACC
TACAAGAACCTGCAGCATCATGAGTACAACGCATTCACCTTCCTAGACCTGAACCTGGACCTCTCCAAGT
TCAGGCTGCCACAGCCGTCTTCGGGACGAGAGTCGCCCCGGCACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001101011
ORF Size 327 bp
Insert Size 327
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001101011.2, NP_001094481.1
RefSeq Size 486
RefSeq ORF 327
Locus ID 64539
Gene Summary heat stable phosphoprotein localized to the mitochondrion; may undergo arachidonic acid dependent phosphorylation by PKN [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.