Fxyd2 (NM_017349) Rat Untagged Clone

CAT#: RN200369

Fxyd2 (untagged ORF) - Rat FXYD domain-containing ion transport regulator 2 (Fxyd2), transcript variant b, (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Fxyd2
• Synonyms: ATP1C; Atp1g1; GNAKATP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN200369 representing NM_017349
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGACAGGTGGTACTTGGGTGGCAGTGCCAAGGGGACGGAGAATCCCTTCGAGTATGACTATGAAACCG
  TCCGCAAAGGAGGCCTGATCTTCGCGGGCCTTGCCTTCGTCGTGGGACTCCTCATTCTCCTCAGCAAAAG
  ATTCCGCTGTGGGGGCAGTAAGAAGCATAGGCAGGTCAATGAAGATGAGCTGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_017349
• ORF Size: 195 bp
• Insert Size: 195
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_017349.2, NP_059045.2
• RefSeq Size: 195
• RefSeq ORF: 195
• Locus ID: 29639
• Gene Summary: This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. This gene, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. Related gene family members have been shown to induce channel activity in experimental expression systems. Transmembrane topology has been established for two family members, with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. The Type III integral membrane protein encoded by this gene is the gamma subunit of the Na,K-ATPase present on the plasma membrane. Although the Na,K-ATPase does not depend on the gamma subunit to be functional, it is thought that the gamma subunit modulates the enzyme's activity by inducing ion channel activity. Two transcript variants have been described for this gene that encode distinct isoforms. [provided by RefSeq, Jan 2010]
  Transcript Variant: This variant (b) contains an alternate exon in the 5' coding region and 5' UTR, compared to variant a. This results in a shorter protein (isoform b) that has a distinct N-terminus, compared to isoform a.