Igf1 (NM_001082477) Rat Untagged Clone

CAT#: RN200510

Igf1 (untagged ORF) - Rat insulin-like growth factor 1 (Igf1), transcript variant 1, (10 ug)


  "NM_001082477" in other vectors (3)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "Igf1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Igf1
Synonyms IGF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN200510 representing NM_001082477
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCGCACCTCCAATAAAGATACACATCATGTCGTCTTCACATCTCTTCTACCTGGCACTCTGCTTGC
TCACCTTTACCAGCTCGGCCACAGCCGGACCAGAGACCCTTTGCGGGGCTGAGCTGGTGGACGCTCTTCA
GTTCGTGTGTGGACCAAGGGGCTTTTACTTCAACAAGCCCACAGGCTATGGCTCCAGCATTCGGAGGGCA
CCACAGACGGGCATTGTGGATGAGTGTTGCTTCCGGAGCTGTGATCTGAGGAGGCTGGAGATGTACTGTG
CTCCGCTGAAGCCTACAAAGTCAGCTCGTTCCATCCGGGCCCAGCGCCACACTGACATGCCCAAGACTCA
GAAGTCCCAGCCCCTATCGACACACAAGAAAAGGAAGCTGCAAAGGAGAAGGAAAGGAAGTACACTTGAA
GAACACAAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001082477
ORF Size 432 bp
Insert Size 432
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001082477.2, NP_001075946.2
RefSeq Size 1582
RefSeq ORF 432
Locus ID 24482
Gene Summary growth factor; plays a major role in mammalian growth [RGD, Feb 2006]
Transcript Variant: This variant (1) differs in the 5' UTR and 5' coding region, compared to variant 3. These differences cause translation initiation from a distinct start codon and result in an isoform (a) with a novel C-terminus, compared to isoform c. This isoform is also known as IIC.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.