Calca (NM_001033956) Rat Untagged Clone

CAT#: RN200525

Calca (untagged ORF) - Rat calcitonin/calcitonin-related polypeptide, alpha (Calca), transcript variant 3, (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Calca
• Synonyms: Cal1; CAL6; Calc; calcitonin; CGRP; RATCAL6
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN200525 representing NM_001033956
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGCTTTCTGAAGTTCTCCCCTTTCCTGGTTGTCAGCATCTTGCTCCTGTACCAGGCATGCGGCCTCC
  AGGCAGTTCCTTTGAGGTCAACCTTGGAAAGCAGCCCAGGCATGGCCACTCTCAGTGAAGAAGAAGCTCG
  CCTACTGGCTGCACTGGTGCAGAACTATATGCAGATGAAAGTCAGGGAGCTGGAGCAGGAGGAGGAACAG
  GAGGCTGAGGGCTCTAGTGTCACTGCCCAGAAGAGATCCTGCAACACTGCCACCTGCGTGACCCATCGGC
  TGGCAGGCTTGCTGAGCAGGTCGGGAGGTGTGGTGAAGGACAACTTTGTGCCCACCAATGTGGGCTCTGA
  AGCCTTCGGCCGCCGCCGCAGGGACCTTCAGGCTTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001033956
• Insert Size: 387 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001033956.1, NP_001029128.1
• RefSeq Size: 967 bp
• RefSeq ORF: 387 bp
• Locus ID: 24241
• Cytogenetics: 1q35
• Gene Summary: an inhibitor of lactotroph function and a potent vasodilator [RGD, Feb 2006]
  Transcript Variant: This variant (3) differs in the 3' UTR and 3' coding sequence compared to variant 1. The resulting isoform (Cgrp) has a shorter and distinct C-terminus compared to isoform Calca.