Tomm22 (NM_212514) Rat Untagged Clone

CAT#: RN200855

Tomm22 (untagged ORF) - Rat translocase of outer mitochondrial membrane 22 homolog (yeast) (Tomm22), nuclear gene encoding mitochondrial protein, (10 ug)


  "NM_212514" in other vectors (3)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "Tomm22"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Tomm22
Synonyms rTOM22; TOM22
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN200855 representing NM_212514
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCGCCGCCGTCGCTGCAGCCGGCGCTGGGGAGCCTCTGTCCCCCGAAGAATTGGTCCCGAAAGCCG
AGGCAGAGAAAGCTGAGGAGGACCTGGAAGAAGACGACGACGACGAGCTAGATGAGACCCTATCGGAGAG
ACTCTGGGGTCTGACGGAGATGTTTCCCGAGAGGGTCCGGTCAGCCGCTGGAGCCACCTTTGATCTCTCG
CTCTTCGTGGCTCAGAAGATGTACAGATTTTCCAGGGCAGCTTTGTGGATTGGGACCACTTCCTTCATGA
TCCTGGTTCTTCCTGTTGTCTTTGAGACAGAAAAGTTGCAAATGGAGCAACAACAGCAACTGCAGCAAAG
GCAGATACTTTTAGGGCCTAACACAGGACTGTCAGGAGGAATGCCAGGGGCTCTACCTCCACTTCCTGGA
AAGATCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_212514
ORF Size 429 bp
Insert Size 429
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_212514.2, NP_997679.1
RefSeq Size 1056
RefSeq ORF 429
Locus ID 300075
Gene Summary Central receptor component of the translocase of the outer membrane of mitochondria (TOM complex) responsible for the recognition and translocation of cytosolically synthesized mitochondrial preproteins. Together with the peripheral receptor TOM20 functions as the transit peptide receptor and facilitates the movement of preproteins into the translocation pore. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.