Pln (NM_022707) Rat Untagged Clone

CAT#: RN200884

Pln (untagged ORF) - Rat phospholamban (Pln), (10 ug)


  "NM_022707" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Pln
Synonyms Plm
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN200884 representing NM_022707
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAAAAGTCCAATACCTTACTCGCTCGGCTATCAGGAGAGCCTCGACTATTGAAATGCCCCAGCAAG
CGCGTCAGAACCTCCAGAACCTCTTTATCAATTTCTGTCTCATCTTGATATGTCTGCTGCTGATCTGCAT
CATTGTGATGCTTCTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_022707
ORF Size 159 bp
Insert Size 159
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_022707.2, NP_073198.1
RefSeq Size 2254
RefSeq ORF 159
Locus ID 64672
Gene Summary may inhibit sarcoplasmic reticulum Ca-ATPase; may play a role in calcium regulation and transport in the heart [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.