Pskh1 (NM_001108897) Rat Untagged Clone

CAT#: RN200885

Pskh1 (untagged ORF) - Rat protein serine kinase H1 (Pskh1), (10 ug)


  "NM_001108897" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Pskh1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Pskh1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN200885 representing NM_001108897
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCTGTGGGACAAGCAAGAAGTCATCACCAACCTTTGTTCTGTCCTTTGGTGTGTTGCCCTTTGCTG
CTTCCCTTCTGGAGCTGCCAGACCCTCCTTTACAGCTCCACTGTGCCACCTACTGTCTGGTCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001108897
ORF Size 135 bp
Insert Size 135
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001108897.1, NP_001102367.1
RefSeq Size 1295
RefSeq ORF 135
Locus ID 364993

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.