Tax1bp3 (NM_001025419) Rat Untagged Clone

CAT#: RN200980

Tax1bp3 (untagged ORF) - Rat Tax1 (human T-cell leukemia virus type I) binding protein 3 (Tax1bp3), (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Tax1bp3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN200980 representing NM_001025419
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCCTACATCCCGGGCCAGCCTGTCACCGCCGTAGTGCAAAGAGTTGAAATTCATAAGTTGCGGCAAG
  GTGAAAACTTAATCCTGGGCTTCAGTATTGGAGGTGGGATCGACCAGGACCCTTCCCAGAATCCCTTCTC
  AGAAGATAAAACAGACAAGGTGAACGGCTGGGACATGACCATGGTCACTCATGACCAGGCTCGGAAGCGG
  CTCACCAAACGTTCGGAGGAAGTGGTCCGCCTGCTGGTGACTCGGCAGTCTCTGCAGAAGGCCGTACAGC
  AGTCCATGCTGTCATAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001025419
• Insert Size: 297 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001025419.1, NP_001020590.1
• RefSeq Size: 1162 bp
• RefSeq ORF: 297 bp
• Locus ID: 360564
• Cytogenetics: 10q24