Tff3 (NM_013042) Rat Untagged Clone

CAT#: RN201140

Tff3 (untagged ORF) - Rat trefoil factor 3, intestinal (Tff3), (10 ug)


  "NM_013042" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Tff3"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Tff3
Synonyms ITF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN201140 representing NM_013042
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGACCAGAGCCTTCTGGATAACCCTGCTGCTGGTCCTGGTTGCTGGGTCCTCCTGCAAAGCCCAGG
AATTTGTTGGCCTATCTCCAAGCCAATGTATGGTCCCGGCAAATGTCAGGGTGGACTGTGGCTACCCCAC
TGTCACATCAGAGCAGTGTAACAACCGTGGTTGCTGTTTTGACTCCAGCATCCCAAATGTGCCCTGGTGC
TTCAAACCTCTGCAAGAGACAGAATGTACGTTTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013042
ORF Size 246 bp
Insert Size 246
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_013042.2, NP_037174.2
RefSeq Size 477
RefSeq ORF 246
Locus ID 25563
Gene Summary plays a role in epithelial wound healing; involved in maintenance of the intestinal mucosa [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.