Smim20 (NM_001134639) Rat Untagged Clone

CAT#: RN201330

RGD1565192 (untagged ORF) - Rat similar to 1810013D10Rik protein (RGD1565192), (10 ug)


  "NM_001134639" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Smim20"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Smim20
Synonyms RGD1565192
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN201330 representing NM_001134639
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCGCGGCCCGGAACCTGCGCACCGCGCTCATATTCGGAGGCTTCATCTCTATGGTCGGAGCCGCCT
TCTACCCTATCTACTTCCGGCCCCTTCTGCGGCTGGAAGAATACCAGAAGGAGCAGGCTGTAAATCGAGC
TGGTATCGTCCAGGAAGATGTGCAGCCACCAGGGTTGAAAGTGTGGTCTGATCCGTTTGGCAGGAAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001134639
ORF Size 210 bp
Insert Size 210
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001134639.2, NP_001128111.2
RefSeq Size 922
RefSeq ORF 210
Locus ID 501923

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.