Smim3 (NM_173126) Rat Untagged Clone

CAT#: RN201450

Smim3 (untagged ORF) - Rat putative small membrane protein NID67 (Nid67), (10 ug)


  "NM_173126" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Smim3"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Smim3
Synonyms Nid67
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN201450 representing NM_173126
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATGCTATCAGCCAATCCCCTGTGGATGTCCTACTGCCCAAGCATATCCTGGATATCTGGGCCATTG
TCCTCATCATCCTGGCTACCGTCGTCATCATGACCTCCTTGTTCCTGTGCCCGGCCACGGCAGTCATCAT
CTATCGAATGCGGACTCATCCAGTTCTCAACGGGGCCGTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_173126
ORF Size 183 bp
Insert Size 183
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_173126.3, NP_775149.1
RefSeq Size 1717
RefSeq ORF 183
Locus ID 286910
Gene Summary may play a role in neurogenesis [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.