Nrgn (NM_024140) Rat Untagged Clone

CAT#: RN201526

Nrgn (untagged ORF) - Rat neurogranin (Nrgn), (10 ug)


  "NM_024140" in other vectors (3)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "Nrgn"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Nrgn
Synonyms BICKS; RC3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN201526 representing NM_024140
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACTGCTGCACGGAGAGCGCCTGCTCCAAGCCAGACGACGATATTCTAGACATCCCGTTGGATGATC
CCGGAGCCAACGCCGCTGCAGCCAAAATCCAGGCGAGTTTTCGGGGCCACATGGCGAGGAAGAAGATAAA
GAGTGGAGAGTGTGGCCGGAAGGGACCCGGCCCCGGGGGACCAGGCGGAGCTGGGGGCGCCCGGGGAGGC
GCGGGCGGCGGCCCCAGCGGAGATTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_024140
ORF Size 237 bp
Insert Size 237
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_024140.2, NP_077054.1
RefSeq Size 1384
RefSeq ORF 237
Locus ID 64356
Gene Summary neuron specific protein kinase C substrate [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.