Atox1 (NM_053359) Rat Untagged Clone

CAT#: RN201859

Atox1 (untagged ORF) - Rat ATX1 antioxidant protein 1 homolog (yeast) (Atox1), (10 ug)


  "NM_053359" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Atox1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Atox1
Synonyms Atx1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN201859 representing NM_053359
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCGAAGCACGAGTTCTCTGTGGACATGACCTGTGGAGGCTGTGCGGAAGCCGTCTCCCGAGTCCTCA
ACAAGCTGGGAGGAGTGGAGTTCAACATTGACTTGCCCAACAAGAAGGTCTGCATTGAGTCTGAGCACAG
CTCAGACATCCTGCTGGCAACTCTCAACAAAACAGGAAAAGCGGTCTCCTACCTTGGCCCCAAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_053359
ORF Size 207 bp
Insert Size 207
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_053359.2, NP_445811.1
RefSeq Size 509
RefSeq ORF 207
Locus ID 84355
Gene Summary plays a role in response to oxidative stress [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.