Cox17 (NM_053540) Rat Untagged Clone

CAT#: RN202000

Cox17 (untagged ORF) - Rat cytochrome c oxidase, subunit XVII assembly protein homolog (S. cerevisiae) (Cox17), (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Cox17
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN202000 representing NM_053540
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCCGGGACTGGCTGCCGCTAGCCCTGCCCCGCCCGAGGCTCAGGAGAAGAAGCCTCTGAAGCCCTGCT
  GTGCCTGCCCGGAGACCAAGAAGGCGCGTGATGCGTGCATCATTGAGAAAGGAGAAGAACACTGTGGACA
  TCTCATCGAGGCCCACAAGGAGTGCATGAGAGCGCTGGGATTTAAGATATGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_053540
• ORF Size: 192 bp
• Insert Size: 192
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_053540.2, NP_445992.1
• RefSeq Size: 440
• RefSeq ORF: 192
• Locus ID: 89786
• Gene Summary: may be essential for the assembly of functional cytochrome c oxidase and delivery of copper ions to the mitochondrion [RGD, Feb 2006]