Defb1 (NM_031810) Rat Untagged Clone

CAT#: RN202072

Defb1 (untagged ORF) - Rat defensin beta 1 (Defb1), (10 ug)


  "NM_031810" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Defb1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Defb1
Synonyms CDK4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN202072 representing NM_031810
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAAACTCATTACTTTCTCCTGGTGATGTTATTTTTTCTCTTCTCCCAGATGGAGCTGGGTGCTGGCA
TTCTCACAAGTCTTGGACGCAGAACAGATCAATACCGATGCCTCCAAAATGGAGGATTCTGTCTCCGCTC
CAGCTGCCCATCTCATACCAAACTACAAGGAACATGTAAACCAGATAAGCCCAACTGTTGCAGGAGTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_031810
ORF Size 210 bp
Insert Size 210
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_031810.1, NP_113998.1
RefSeq Size 416
RefSeq ORF 210
Locus ID 83687
Gene Summary cationic peptides with broad-spectrum antimicrobial activity; may mediate mucosal defenses of several organs [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.