Usmg5 (NM_133544) Rat Untagged Clone

CAT#: RN202082

Usmg5 (untagged ORF) - Rat up-regulated during skeletal muscle growth 5 homolog (mouse) (Usmg5), (10 ug)


  "NM_133544" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Usmg5"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Usmg5
Synonyms Dapit; Usmg5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN202082 representing NM_133544
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGGCCCAGAAAGTGATGGCCAATTCCAGTTCACTGGTATTAAAAAATATTTCAACTCTTATACCC
TCACAGGTAGAATGAATTGTGTCCTGGCCACATATGGAGGCATTGCTTTGTTGGTCCTATACTTTAAGTT
AAGGCCTAAAAAAACCCCAGCTGTGAAAGCAACATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_133544
ORF Size 177 bp
Insert Size 177
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_133544.1, NP_598228.1
RefSeq Size 322
RefSeq ORF 177
Locus ID 171069
Gene Summary a novel protein that is upregulated in streptozotocin-induced diabetic rats [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.