Rpl41 (NM_139083) Rat Untagged Clone

CAT#: RN202482

Rpl41 (untagged ORF) - Rat ribosomal protein L41 (Rpl41), (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Rpl41
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN202482 representing NM_139083
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGAGCGAAGTGGCGGAAGAAGAGAATGCGCAGGCTGAAGCGCAAGAGAAGAAAGATGAGGCAGAGGT
  CCAAGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_139083
• ORF Size: 78 bp
• Insert Size: 78
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_139083.2, NP_620783.1
• RefSeq Size: 467
• RefSeq ORF: 78
• Locus ID: 124440
• Gene Summary: structural component of the 60S ribosomal subunit; contains 25 amino acids [RGD, Feb 2006]