Rpl41 (NM_139083) Rat Untagged Clone

CAT#: RN202482

Rpl41 (untagged ORF) - Rat ribosomal protein L41 (Rpl41), (10 ug)


  "NM_139083" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Rpl41"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Rpl41
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN202482 representing NM_139083
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGAGCGAAGTGGCGGAAGAAGAGAATGCGCAGGCTGAAGCGCAAGAGAAGAAAGATGAGGCAGAGGT
CCAAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_139083
ORF Size 78 bp
Insert Size 78
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_139083.2, NP_620783.1
RefSeq Size 467
RefSeq ORF 78
Locus ID 124440
Gene Summary structural component of the 60S ribosomal subunit; contains 25 amino acids [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.