Pde6h (NM_053688) Rat Untagged Clone

CAT#: RN202587

Pde6h (untagged ORF) - Rat phosphodiesterase 6H, cGMP-specific, cone, gamma (Pde6h), (10 ug)


  "NM_053688" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Pde6h"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Pde6h
Synonyms Pde6g
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN202587 representing NM_053688
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCGACAGCCCTTGCCTGAGTCCTCCAGCACCAAGCCAGGGTCCTACTACCCCACGCAAAGGGCCCC
CCAAGTTCAAGCAGAGGCAGACGCGACAGTTCAAGAGCAAGCCTCCCAAGAAAGGGGTGAAAGGGTTTGG
AGATGACATCCCAGGCATGGAGGGGCTAGGAACAGATATCACGGTGATCTGCCCCTGGGAAGCATTCAGC
CACCTGGAACTGCACGAGCTGGCTCAGTTCGGGATCATCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_053688
ORF Size 252 bp
Insert Size 252
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_053688.2, NP_446140.1
RefSeq Size 480
RefSeq ORF 252
Locus ID 114248
Gene Summary mouse homolog may play a role in mitogen activated protein kinase signaling [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.