Guca2a (NM_013118) Rat Untagged Clone

CAT#: RN202610

Guca2a (untagged ORF) - Rat guanylate cyclase activator 2a (guanylin) (Guca2a), (10 ug)


  "NM_013118" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Guca2a"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Guca2a
Synonyms GUANYL; Guanylin; Guca2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN202610 representing NM_013118
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAATGCCTGGTTGCTGTCTGTGCTGTGCCTCCTGGGTGCCTTGGCTGTCCTGGTAGAAGGGGTCACTG
TGCAGGATGGAGACCTTTCCTTTCCTCTGGAGTCAGTGAAACAACTTAAGCACCTCCGGGAAGTACAGGA
GCCCACACTGATGAGTCACAAGAAGTTTGCTCTCAGGCTTCCGAAGCCTGTGGCACCAGAGCTATGTAGC
CAATCTGCATTTCCAGAAGCACTGAGGCCCCTCTGCGAGAAACCCAACGCCGAGGAGATCCTGCAGAGGC
TAGAGGCCATTGCTCAGGACCCAAACACATGTGAAATCTGTGCCTATGCTGCCTGCACGGGATGCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013118
ORF Size 348 bp
Insert Size 348
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_013118.1, NP_037250.1
RefSeq Size 567
RefSeq ORF 348
Locus ID 25656
Gene Summary activated peptide mediates increase in cGMP; may act as a ligand for guanylyl cyclase C [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.